stat3 expression construct Search Results


90
Becton Dickinson stat3-c
Stat3 C, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/pstat3+antibody/pmc03371412-329-12-33
Average 90 stars, based on 1 article reviews
stat3-c - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

95
Selleck Chemicals stat3
(A) Schematic of the genomic region proximal to the RLN2 transcriptional start site (UCSC genome browser-human GRCh37/hg19). Species conservation is indicated. Boundaries of 3 relaxin promoter (RP) constructs, RP-1, RP-2, and RP-3, are mapped. Predicted binding sites for <t>STAT3,</t> NF-κB, and SOX9 are indicated. (B) Luciferase activity of the indicated RP constructs compared with empty vector control (EV) in OVCAR8 and SKOV3. Luciferase activity is normalized to Renila activity. For this and subsequent experiments, error bars indicate mean ± SEM. n = 3. (C) Genomic region of the RLN2 promoter (RP-3) compared with the RLN1 promoter. Peaks indicate species conservation. Red bars in the RP-3 sequence indicate single nucleotide differences in RLN1 compared with RLN2, and the open box indicates a small sequence not present in RLN1. Predicted binding sites for STAT3, NF-κB, and SOX9 are indicated. (D) RP-3 luciferase activity in cells transfected with control siRNA (siCON) or siRNA targeting STAT3 or SOX9. n = 3. (E) RP-3 luciferase activity in cells expressing shGFP or hairpins targeting NFκB1 or NFκB2 subunits (sh-NFκB1 and sh-NFκB2). n = 3. (F) Relaxin expression and STAT3 phosphorylation (pY705) in OVCAR8 treated for 48 hours with small molecule inhibitors of STAT3 (STATTIC, 1 μM) or NF-κB (QNZ, 5 nM) compared with mock-treated (–) cells. (G) RP3-luciferase activity in OVCAR8 and SKOV3 treated with 1%FBS, IL-6 (50 ng/mL), or TNF-α (50 ng/mL) for 24 hours compared with untreated cells. n = 3. (H) Relaxin levels and STAT3 phosphorylation (pY705) in OVCAR8 treated with IL-6 (50 ng/mL) or control (–) 24 hours after treatment with the JAK1/2 inhibitor Ruxolitinib (+Rux) compared with DMSO. (I and J) ChIP analysis of TF occupancy at the RLN1 promoter (I) and RLN2 promoter (J). ChIP signals are shown as fold enrichment over IgG. n = 3.
Stat3, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/STAT3-IN-1/pmc08011889-815-1-12
Average 95 stars, based on 1 article reviews
stat3 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology stat3
Binding of nuclear proteins to the Sp1(−117) site. (A) Supershift analysis using an antibody (Ab) against Sp1. Nuclear extracts were prepared from control or IL-6-treated HepG2 cells by a method that maximizes the extraction of Sp1 (see Materials and Methods). The extracts were incubated with either NRS or an Sp1-specific antibody and the δAPRE/Sp1 or δAPRE probe. The supershift generated by the Sp1 antibody in lanes 2 and 4 is indicated. (B and C) Binding of recombinant Sp1 to the δAPRE/Sp1 (B) and δAPRE (C) probes. Recombinant human Sp1 (50 ng) was used alone (lanes 5 and 10) or mixed with 8 μg of HepG2 nuclear extract (optimized for Stat protein extraction) from control or IL-6-treated cells. <t>Stat3</t> antibody was added to the indicated reactions. The lower panel is a longer exposure of the top portion of the gel to emphasize the Stat3 antibody supershift complex.
Stat3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/Stat3+Antibody/pmc00121443-148-13-6
Average 96 stars, based on 1 article reviews
stat3 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc stat3 rabbit monoclonal antibody
( A ) The knockdown expression of <t>STAT3</t> and pSTAT3 was confirmed by WB in MCF7 cells. GAPDH was used as an internal control. ( B ) MTS assay was used to detect the effect of STAT3 knockdown on proliferation in MCF7 cells. * P < 0.05. ( C and D ) Scratch assay was performed to evaluate the effect of STAT3 knockdown on cell migration. * P < 0.05. ( E ) Transfectants of STAT3 and vector control in MCF7 cells were identified by WB. More abundant STAT3 was detected after STAT3 transfection compared with the control vector transfection. ( F ) MTS assay was used to detect the effect of STAT3 overexpression on proliferation in MCF7 cells.* P < 0.05. ( G and H ) Scratch assay was performed to evaluate the effect of STAT3 overexpression on cell migration. * P < 0.05.
Stat3 Rabbit Monoclonal Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/Stat3+Rabbit+mAb/pmc05630363-113-12-17
Average 96 stars, based on 1 article reviews
stat3 rabbit monoclonal antibody - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc phospho stat3
Phenotypic effects of dysregulated CISH in OSCC cell lines. (A) Western blot analysis of the <t>STAT3,</t> 5 and their phosphorylation form after transfection of control vector (Vec) or CISH expression vector (CISH) for 48 h in SAS and SCC-4 cells. GAPDH was used as protein loading control. Numerical values for protein band intensities are shown below the gels. The values were quantitated by densitometry and normalized to GAPDH. (B) The effect of CISH on the transcriptional activity of the construct containing the STAT3 binding sequence. The relative luciferase activities are the ratios of Renilla luciferase normalized to the vector alone control. (C) Migration assay following CISH overexpression for 24 h using Matrigel non-coated Boyden chamber assay in SAS and SCC-4 cells. (D) Invasion assay following CISH overexpression for 24 h using Matrigel coated Boyden chamber assay in SAS and SCC-4 cells. (E) CCL3, CCL5 and IL-1β levels in cultured medium of CISH overexpression SAS and SCC-4 cells measured by ELISA (compared with Vec control). (F) Western blot analysis of the CISH, COX-2 and iNOS after transfection of CISH for 48 h in SAS and SCC-4 cells. GAPDH was used as protein loading control. All data are represented as mean ± SD; **, p < 0.01; ***, p < 0.001.
Phospho Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/Phospho-Stat5+(Tyr694)+Rabbit+mAb/pmc07505767-77-31-37
Average 96 stars, based on 1 article reviews
phospho stat3 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

97
Cell Signaling Technology Inc stat3
PRMT5 potentiates <t>STAT3</t> activation via Smad7. A) PRMT5 depletion dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shPRMT5‐1 or shPRMT5‐2 or Control (shCtrl) were harvested and analyzed by using western blotting with indicated antibodies. B) Knockdown of PRMT5 attenuates IL‐6‐induced STAT3 phosphorylation in MCF10A cells. MCF10A cells were transfected with 40 pm siRNA against PRMT5. 36 h later, cells were treated with IL‐6 (10 ng mL −1 ) for the indicated time and harvested for western blotting analysis with appropriate antibodies. C) PRMT5 inhibition attenuates endogenous activation of STAT3 in H358 cells. H358 cells were treated with 20 × 10 −6 m of PRMT5 inhibitors EPZ015666 or GSK591 for the indicated time. Cell lysates were collected and subject to western blotting analysis. SDMA indicates global arginine di‐methylation. D) Smad7 potentiates STAT3 activation in A549 cells. A549 cells stably expressing FLAG‐GFP or FLAG‐Smad7 were harvested and subject to Western blotting analysis using appropriate antibodies. E) Stable knockdown of Smad7 dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shSmad7 or shCtrl were harvested and subject to western blotting analysis using appropriate antibodies. F) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF7 cells. Cells were transfected with siSmad7 (40 pm) and treated with IL‐6 (10 ng mL −1 ) for the indicated time. Cells were harvested and analyzed by western blotting with appropriate antibodies. G) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF10A cells. Cell transfection, treatment, and Western blotting were done as described in Panel F. H) PRMT5 potentiates STAT3 activation dependent of Smad7. MCF10A cells were transduced with lentiviral particles expressing HA‐PRMT5 or HA‐G367A/R368A. After 24 h, cells were transfected with 40 pm siSmad7. 12 h later, cells were stimulated with IL‐6 (2 ng mL −1 ) for the indicated time. Cell lysates were harvested and subject to Western blotting analysis using appropriate antibodies.
Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/Stat3+Mouse+mAb/pmc08132155-190-17-25
Average 97 stars, based on 1 article reviews
stat3 - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

92
Addgene inc castat3
Fig. 1. <t>STAT3</t> reduced 6-OHDA neurotoxicity in N27 cell lines. Control N27 cells were examined in the absence (A) or presence (B) of 50 µM 6-OHDA for 24 h. N27 cells expressing <t>caSTAT3</t> were examined in the absence (C) or presence (D) of 50 µM 6-OHDA for 24 h E) Graphical plot illustrating that caSTAT3 transfected N27 cells reduced percentage of cell deaths under 6-OHDA induced neurotoxicity. Three different batches of cell culture used. Result in mean ± SE. For each sample a minimum of 10,000 cells were recorded. The pink box represents the FVD + population of dead cells. The cells were double stained with FVD eFluor 660 and Annexin V-PE. The FVD-/Annexin V- population is regarded as normal healthy cells, while FVD-/AnnexinV + population is early apoptotic cells, and FVD+/AnnexinV+/- population represents necrotic/late apoptotic like cell death. Expression of caSTAT3 greatly reduced the percentage of dead cells 24 h after 6-OHDA treatment. F) Western blot analysis showed expression of phosphorylated STAT3 (pSTAT3) at Tyr705 (lane 3). An upregulation of pSTAT3 expression was found when compared to non-infected (lane 1) or GFP (lane 2) transfected N27 cell lysates. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Castat3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/pMXs-Stat3-C+(Plasmid+%2313373)/pm38030102-54-23-31
Average 92 stars, based on 1 article reviews
castat3 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

94
Addgene inc stat3 sequences
(A) Immunoblots for pY705 <t>STAT3,</t> pS727 STAT3, and total STAT3 in Trp53/Pten −/− cells that are ispinesib naive and resistant. (B–D) Quantitation of total STAT3/β actin (B), pY705 STAT3/total STAT3 (C), and pS727 STAT3/total STAT3 (D) in ispinesib-naive (blue) and -resistant (red) cells, with three biological replicates of each. Statistical significance assessed with a two-tailed t test. (E and F) Western blot intensity, normalized to β actin, of pY705 STAT3 (E) and pS727 STAT3 (F) in ispinesib-naive (Naive) and -resistant (Res) cells, with the former treated with DMSO vehicle (Veh) and the latter treated with DMSO vehicle (Veh), 500 nM saracatinib (Sara), or 500 nM dasatinib (Dasa). (G) Western blot intensity, normalized to β actin, of total STAT3 in ispinesib-naive (Naive) and -resistant (Res) cells, with the former treated with DMSO vehicle (Veh) and the latter treated with DMSO vehicle (Veh), 500 nM saracatinib (Sara), or 500 nM dasatinib (Dasa). For (E)–(G), please refer to and for the corresponding images of the western blots. Statistical significance determined using a pairwise two-tailed t test. (H–J) Quantitation of pY705 STAT3 (H), pS727 STAT3 (I), and total STAT3 (J), all normalized to β actin for ispinesib-naive cells treated with vehicle (solid blue circles; Naive Veh), ispinesib-resistant cells treated with vehicle (solid red circles; Res Veh), and ispinesib-resistant cells treated with 500 nM erlotinib (open red circles; Res Erlot). Statistical significance was determined by pairwise two-tailed t test. For (H)–(J), please refer to for the corresponding images of the western blots. (K) Dose-response curves for ispinesib-naive (solid blue circles) and -resistant (solid red circles) cells in the absence and presence of 75 nM ispinesib (open red circles) for the STAT3 inhibitor SH5–07. (L and M) Effect of shRNA suppression of STAT3 on ispinesib resistance. Please refer to for the corresponding western blot for STAT3, which shows >90% knockdown with two STAT3-directed shRNAs. Statistical significance determined using a pairwise two-tailed t test. (N) Ispinesib-naive and -resistant cells were treated for 24 h with 1 μM doxorubicin, and cell lysates were probed by western blot for full-length caspase 3 (FL Caspase 3) and cleaved caspase 3 (Cl Caspase 3). (O) Ispinesib-naive and -resistant cells were lysed, and mitochondria (Mito) were separated from the cytoplasm (Cyto) by centrifugation. Western blot shows that ispinesib resistance is associated with a marked increase in mitochondrial STAT3 that is phosphorylated on S727. Loading controls include α tubulin for the cytoplasmic and cytochrome c oxidase ( COX4 ) for the mitochondrial fractions. (P) Ispinesib-naive and -resistant cells were lysed, and nuclei (Nuc) were separated from the cytoplasm (Cyto) by centrifugation. Western blot shows that ispinesib resistance is associated with a marked increase in nuclear STAT3 that is phosphorylated on Y705. Loading controls include a tubulin for the cytoplasmic and histone H3 for the nuclear fractions. (Q) Ispinesib-naive cells were transfected with STAT3 S727A, STAT3 S727D, STAT3-C, or STAT3 S727D + STAT3-C constructs, each fused to the FLAG epitope. After confirmation of expression of the STAT3 mutant , cells were treated with a range of ispinesib concentrations, and cell viability was measured at 72 h. While transfection of either STAT3-S727D or STAT3-C increases the EC 50 of ispinesib by ~20-fold, co-transfection of both of these constructs is required to increase the ispinesib EC 50 to that seen for ispinesib-resistant cells ( ; ).
Stat3 Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/STAT3(Y705F)-TAL-Luc+(Plasmid+%2346933)/pmc10018805-344-0-9
Average 94 stars, based on 1 article reviews
stat3 sequences - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

92
Addgene inc plegfp y705f stat3
(A) Immunoblots for pY705 <t>STAT3,</t> pS727 STAT3, and total STAT3 in Trp53/Pten −/− cells that are ispinesib naive and resistant. (B–D) Quantitation of total STAT3/β actin (B), pY705 STAT3/total STAT3 (C), and pS727 STAT3/total STAT3 (D) in ispinesib-naive (blue) and -resistant (red) cells, with three biological replicates of each. Statistical significance assessed with a two-tailed t test. (E and F) Western blot intensity, normalized to β actin, of pY705 STAT3 (E) and pS727 STAT3 (F) in ispinesib-naive (Naive) and -resistant (Res) cells, with the former treated with DMSO vehicle (Veh) and the latter treated with DMSO vehicle (Veh), 500 nM saracatinib (Sara), or 500 nM dasatinib (Dasa). (G) Western blot intensity, normalized to β actin, of total STAT3 in ispinesib-naive (Naive) and -resistant (Res) cells, with the former treated with DMSO vehicle (Veh) and the latter treated with DMSO vehicle (Veh), 500 nM saracatinib (Sara), or 500 nM dasatinib (Dasa). For (E)–(G), please refer to and for the corresponding images of the western blots. Statistical significance determined using a pairwise two-tailed t test. (H–J) Quantitation of pY705 STAT3 (H), pS727 STAT3 (I), and total STAT3 (J), all normalized to β actin for ispinesib-naive cells treated with vehicle (solid blue circles; Naive Veh), ispinesib-resistant cells treated with vehicle (solid red circles; Res Veh), and ispinesib-resistant cells treated with 500 nM erlotinib (open red circles; Res Erlot). Statistical significance was determined by pairwise two-tailed t test. For (H)–(J), please refer to for the corresponding images of the western blots. (K) Dose-response curves for ispinesib-naive (solid blue circles) and -resistant (solid red circles) cells in the absence and presence of 75 nM ispinesib (open red circles) for the STAT3 inhibitor SH5–07. (L and M) Effect of shRNA suppression of STAT3 on ispinesib resistance. Please refer to for the corresponding western blot for STAT3, which shows >90% knockdown with two STAT3-directed shRNAs. Statistical significance determined using a pairwise two-tailed t test. (N) Ispinesib-naive and -resistant cells were treated for 24 h with 1 μM doxorubicin, and cell lysates were probed by western blot for full-length caspase 3 (FL Caspase 3) and cleaved caspase 3 (Cl Caspase 3). (O) Ispinesib-naive and -resistant cells were lysed, and mitochondria (Mito) were separated from the cytoplasm (Cyto) by centrifugation. Western blot shows that ispinesib resistance is associated with a marked increase in mitochondrial STAT3 that is phosphorylated on S727. Loading controls include α tubulin for the cytoplasmic and cytochrome c oxidase ( COX4 ) for the mitochondrial fractions. (P) Ispinesib-naive and -resistant cells were lysed, and nuclei (Nuc) were separated from the cytoplasm (Cyto) by centrifugation. Western blot shows that ispinesib resistance is associated with a marked increase in nuclear STAT3 that is phosphorylated on Y705. Loading controls include a tubulin for the cytoplasmic and histone H3 for the nuclear fractions. (Q) Ispinesib-naive cells were transfected with STAT3 S727A, STAT3 S727D, STAT3-C, or STAT3 S727D + STAT3-C constructs, each fused to the FLAG epitope. After confirmation of expression of the STAT3 mutant , cells were treated with a range of ispinesib concentrations, and cell viability was measured at 72 h. While transfection of either STAT3-S727D or STAT3-C increases the EC 50 of ispinesib by ~20-fold, co-transfection of both of these constructs is required to increase the ispinesib EC 50 to that seen for ispinesib-resistant cells ( ; ).
Plegfp Y705f Stat3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/pLEGFP-Y705F-STAT3+(Plasmid+%2371445)/pmc07181646-363-17-18
Average 92 stars, based on 1 article reviews
plegfp y705f stat3 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

98
Cell Signaling Technology Inc anti phospho stat3 tyr705 rabbit monoclonal antibody
a HCT116 was transfected with pcDNA3.1-VMP1 vector for 48 h, the mRNA expression level of VMP1 and miR-21 was measured by qPCR. b HCT116 was transfected with the small activating RNA (saRNA) targeting VMP1 promoter for 48 h, then the mRNA expression of VMP1 was measured by qPCR. c HCT116 was transfected with saRNA-158 for 48 h, the mRNA and protein expression level of VMP1 was measured by Western blot and qPCR, miR-21 expression and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. d HCT116 was transfected with pEGFP-C3-hGLI3 vector for 48 h, the mRNA expression level of GLI3, VMP1, miR-21, and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. e HCT116 was transfected with <t>pEGFP-N1-STAT3</t> vector for 48 h, the mRNA expression level of STAT3, VMP1, and the number of pri-miR-21 were measured by qPCR. f HCT116 was transfected with saRNA-158 and pEGFP-C3-hGLI3 vector, then CHIP-qPCR analyses using phospho-STAT3 <t>(Tyr705)</t> special antibody were performed. Primer specific for the binding sites of STAT3 to the pri-miR-21 promoter region. Data are presented as mean ± SD. *** P < 0.001, ** P < 0.01, * P < 0.05.
Anti Phospho Stat3 Tyr705 Rabbit Monoclonal Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/Phospho-Stat3+(Tyr705)+XP+Rabbit+mAb/pmc07736343-183-12-21
Average 98 stars, based on 1 article reviews
anti phospho stat3 tyr705 rabbit monoclonal antibody - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc phospho stat3 tyr705
FIG. 1. <t>Stat3</t> activation inhibits A375 melanoma cell proliferation. A, nuclear extracts from ASER cells stimu- lated with 1 M 4HT for the indicated times were incubated with an immobi- lized Stat3 consensus oligonucleotide, and the amount of bound Stat3ER was ana- lyzed by Western blotting (left panel). The total amount of Stat3ER expressed in ASER cells was evaluated by Western blotting (right panel). B, ASER cells transfected with an APRE-luciferase re- porter and the Renilla plasmid were treated with OSM, 4HT (left panel), or the combination of OSM and 4HT (right panel) for 24 h. Luciferase activity was determined and normalized to the Renilla internal control. C, ASER cells were stim- ulated with 100 ng/ml OSM, 1 M 4HT, or the combination of OSM and 4HT, and cell number was determined at the times indicated. The experiments were per- formed a minimum of three times, and a typical result is shown. The bars repre- sent averages of three determinations S.D.
Phospho Stat3 Tyr705, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+construct/Phospho-Stat3+(Tyr705)+Antibody/10__1074_slash_jbc__m312581200-72-35-40
Average 96 stars, based on 1 article reviews
phospho stat3 tyr705 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


(A) Schematic of the genomic region proximal to the RLN2 transcriptional start site (UCSC genome browser-human GRCh37/hg19). Species conservation is indicated. Boundaries of 3 relaxin promoter (RP) constructs, RP-1, RP-2, and RP-3, are mapped. Predicted binding sites for STAT3, NF-κB, and SOX9 are indicated. (B) Luciferase activity of the indicated RP constructs compared with empty vector control (EV) in OVCAR8 and SKOV3. Luciferase activity is normalized to Renila activity. For this and subsequent experiments, error bars indicate mean ± SEM. n = 3. (C) Genomic region of the RLN2 promoter (RP-3) compared with the RLN1 promoter. Peaks indicate species conservation. Red bars in the RP-3 sequence indicate single nucleotide differences in RLN1 compared with RLN2, and the open box indicates a small sequence not present in RLN1. Predicted binding sites for STAT3, NF-κB, and SOX9 are indicated. (D) RP-3 luciferase activity in cells transfected with control siRNA (siCON) or siRNA targeting STAT3 or SOX9. n = 3. (E) RP-3 luciferase activity in cells expressing shGFP or hairpins targeting NFκB1 or NFκB2 subunits (sh-NFκB1 and sh-NFκB2). n = 3. (F) Relaxin expression and STAT3 phosphorylation (pY705) in OVCAR8 treated for 48 hours with small molecule inhibitors of STAT3 (STATTIC, 1 μM) or NF-κB (QNZ, 5 nM) compared with mock-treated (–) cells. (G) RP3-luciferase activity in OVCAR8 and SKOV3 treated with 1%FBS, IL-6 (50 ng/mL), or TNF-α (50 ng/mL) for 24 hours compared with untreated cells. n = 3. (H) Relaxin levels and STAT3 phosphorylation (pY705) in OVCAR8 treated with IL-6 (50 ng/mL) or control (–) 24 hours after treatment with the JAK1/2 inhibitor Ruxolitinib (+Rux) compared with DMSO. (I and J) ChIP analysis of TF occupancy at the RLN1 promoter (I) and RLN2 promoter (J). ChIP signals are shown as fold enrichment over IgG. n = 3.

Journal: The Journal of Clinical Investigation

Article Title: Inhibition of relaxin autocrine signaling confers therapeutic vulnerability in ovarian cancer

doi: 10.1172/JCI142677

Figure Lengend Snippet: (A) Schematic of the genomic region proximal to the RLN2 transcriptional start site (UCSC genome browser-human GRCh37/hg19). Species conservation is indicated. Boundaries of 3 relaxin promoter (RP) constructs, RP-1, RP-2, and RP-3, are mapped. Predicted binding sites for STAT3, NF-κB, and SOX9 are indicated. (B) Luciferase activity of the indicated RP constructs compared with empty vector control (EV) in OVCAR8 and SKOV3. Luciferase activity is normalized to Renila activity. For this and subsequent experiments, error bars indicate mean ± SEM. n = 3. (C) Genomic region of the RLN2 promoter (RP-3) compared with the RLN1 promoter. Peaks indicate species conservation. Red bars in the RP-3 sequence indicate single nucleotide differences in RLN1 compared with RLN2, and the open box indicates a small sequence not present in RLN1. Predicted binding sites for STAT3, NF-κB, and SOX9 are indicated. (D) RP-3 luciferase activity in cells transfected with control siRNA (siCON) or siRNA targeting STAT3 or SOX9. n = 3. (E) RP-3 luciferase activity in cells expressing shGFP or hairpins targeting NFκB1 or NFκB2 subunits (sh-NFκB1 and sh-NFκB2). n = 3. (F) Relaxin expression and STAT3 phosphorylation (pY705) in OVCAR8 treated for 48 hours with small molecule inhibitors of STAT3 (STATTIC, 1 μM) or NF-κB (QNZ, 5 nM) compared with mock-treated (–) cells. (G) RP3-luciferase activity in OVCAR8 and SKOV3 treated with 1%FBS, IL-6 (50 ng/mL), or TNF-α (50 ng/mL) for 24 hours compared with untreated cells. n = 3. (H) Relaxin levels and STAT3 phosphorylation (pY705) in OVCAR8 treated with IL-6 (50 ng/mL) or control (–) 24 hours after treatment with the JAK1/2 inhibitor Ruxolitinib (+Rux) compared with DMSO. (I and J) ChIP analysis of TF occupancy at the RLN1 promoter (I) and RLN2 promoter (J). ChIP signals are shown as fold enrichment over IgG. n = 3.

Article Snippet: For STAT3 and NFKB inhibition, cells were treated with Stattic (1 μM, Selleckchem S7024) or QNZ (5nM, Selleckchem S4902) for 16 to 48 hours.

Techniques: Construct, Binding Assay, Luciferase, Activity Assay, Plasmid Preparation, Sequencing, Transfection, Expressing

Binding of nuclear proteins to the Sp1(−117) site. (A) Supershift analysis using an antibody (Ab) against Sp1. Nuclear extracts were prepared from control or IL-6-treated HepG2 cells by a method that maximizes the extraction of Sp1 (see Materials and Methods). The extracts were incubated with either NRS or an Sp1-specific antibody and the δAPRE/Sp1 or δAPRE probe. The supershift generated by the Sp1 antibody in lanes 2 and 4 is indicated. (B and C) Binding of recombinant Sp1 to the δAPRE/Sp1 (B) and δAPRE (C) probes. Recombinant human Sp1 (50 ng) was used alone (lanes 5 and 10) or mixed with 8 μg of HepG2 nuclear extract (optimized for Stat protein extraction) from control or IL-6-treated cells. Stat3 antibody was added to the indicated reactions. The lower panel is a longer exposure of the top portion of the gel to emphasize the Stat3 antibody supershift complex.

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: Binding of nuclear proteins to the Sp1(−117) site. (A) Supershift analysis using an antibody (Ab) against Sp1. Nuclear extracts were prepared from control or IL-6-treated HepG2 cells by a method that maximizes the extraction of Sp1 (see Materials and Methods). The extracts were incubated with either NRS or an Sp1-specific antibody and the δAPRE/Sp1 or δAPRE probe. The supershift generated by the Sp1 antibody in lanes 2 and 4 is indicated. (B and C) Binding of recombinant Sp1 to the δAPRE/Sp1 (B) and δAPRE (C) probes. Recombinant human Sp1 (50 ng) was used alone (lanes 5 and 10) or mixed with 8 μg of HepG2 nuclear extract (optimized for Stat protein extraction) from control or IL-6-treated cells. Stat3 antibody was added to the indicated reactions. The lower panel is a longer exposure of the top portion of the gel to emphasize the Stat3 antibody supershift complex.

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Binding Assay, Incubation, Generated, Recombinant, Protein Extraction

Replacement of the C/EBPδ APRE with SBEs from ICAM-1 or C/EBPβ renders the promoter responsive to IFN-γ. (A) The C/EBPβ promoter contains an SBE that binds Stat1 and Stat3. A probe containing the putative SBE from the C/EBPβ promoter and Stat1- or α-Stat3-specific antibody (Ab) (lanes 3 and 4, respectively) were added to nuclear extracts from control (lane 1) or IL-6 treated (lanes 2 to 4) HepG2 cells and the reactions analyzed by EMSA. Antibody supershift species are indicated. (B) Comparison of SBE sequences from the C/EBPδ, C/EBPβ, and ICAM-1 promoters. Bases that differ from the C/EBPδ APRE sequence are underlined. (C) IL-6 and IFN-γ responsiveness of SBE swap mutants. Constructs in which the C/EBPδ APRE was exchanged with SBEs from the C/EBPβ or ICAM-1 genes were generated. These constructs and (−127)-Luc were cotransfected with pRSV β-gal into Hep3B cells and assayed for basal expression and IL-6 or IFN-γ inducibility. The values represent the average of three independent experiments. Relative basal expression was normalized to the (−127)-Luc level.

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: Replacement of the C/EBPδ APRE with SBEs from ICAM-1 or C/EBPβ renders the promoter responsive to IFN-γ. (A) The C/EBPβ promoter contains an SBE that binds Stat1 and Stat3. A probe containing the putative SBE from the C/EBPβ promoter and Stat1- or α-Stat3-specific antibody (Ab) (lanes 3 and 4, respectively) were added to nuclear extracts from control (lane 1) or IL-6 treated (lanes 2 to 4) HepG2 cells and the reactions analyzed by EMSA. Antibody supershift species are indicated. (B) Comparison of SBE sequences from the C/EBPδ, C/EBPβ, and ICAM-1 promoters. Bases that differ from the C/EBPδ APRE sequence are underlined. (C) IL-6 and IFN-γ responsiveness of SBE swap mutants. Constructs in which the C/EBPδ APRE was exchanged with SBEs from the C/EBPβ or ICAM-1 genes were generated. These constructs and (−127)-Luc were cotransfected with pRSV β-gal into Hep3B cells and assayed for basal expression and IL-6 or IFN-γ inducibility. The values represent the average of three independent experiments. Relative basal expression was normalized to the (−127)-Luc level.

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Sequencing, Construct, Generated, Expressing

The C/EBPδ APRE competes for binding of Stat3 to the α2-m APRE. (A) EMSA using the rat α2-m APRE, nuclear extracts (6.5 μg) from HepG2 cells, and NRS or Stat3-specific antibody (Ab) as indicated. The HepG2 cells were treated with IL-6 for 15 min. An upper complex (u) and a lower complex (l) appear in the IL-6-treated extracts (lane 3). The Stat3 antibody supershift complex (lane 4) is indicated. (B) Competition for Stat3 binding by the C/EBPδ APRE. Nuclear extracts (10 μg) from IL-6 treated HepG2 cells were incubated with Stat3-specific antibody and 10× (lanes 3 and 6), 30× (lanes 4 and 7), or 100× (lanes 5 and 8) molar excess of unlabeled wild-type (δAPRE) or mutant (δAPREm) binding site, as indicated. The rat α2-m APRE was used as a probe. The film was overexposed to emphasize the supershifted complex.

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: The C/EBPδ APRE competes for binding of Stat3 to the α2-m APRE. (A) EMSA using the rat α2-m APRE, nuclear extracts (6.5 μg) from HepG2 cells, and NRS or Stat3-specific antibody (Ab) as indicated. The HepG2 cells were treated with IL-6 for 15 min. An upper complex (u) and a lower complex (l) appear in the IL-6-treated extracts (lane 3). The Stat3 antibody supershift complex (lane 4) is indicated. (B) Competition for Stat3 binding by the C/EBPδ APRE. Nuclear extracts (10 μg) from IL-6 treated HepG2 cells were incubated with Stat3-specific antibody and 10× (lanes 3 and 6), 30× (lanes 4 and 7), or 100× (lanes 5 and 8) molar excess of unlabeled wild-type (δAPRE) or mutant (δAPREm) binding site, as indicated. The rat α2-m APRE was used as a probe. The film was overexposed to emphasize the supershifted complex.

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Binding Assay, Incubation, Mutagenesis

Selective binding of Stat3 to the C/EBPδ APRE. Nuclear extracts from control or IL-6-treated HepG2 cells were analyzed by EMSA using the wild-type or mutant C/EBPδ APRE probes and control antiserum or Stat1- or Stat3-specific antibody (Ab), as indicated. The film was overexposed to emphasize the supershift signal.

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: Selective binding of Stat3 to the C/EBPδ APRE. Nuclear extracts from control or IL-6-treated HepG2 cells were analyzed by EMSA using the wild-type or mutant C/EBPδ APRE probes and control antiserum or Stat1- or Stat3-specific antibody (Ab), as indicated. The film was overexposed to emphasize the supershift signal.

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Binding Assay, Mutagenesis

Stat3 mediates IL-6-induced expression from the C/EBPδ promoter. (A) Stat3 but not Stat1 transactivates the C/EBPδ promoter. The (−127)-Luc construct was cotransfected into Hep3B cells with expression vectors for Stat1 or Stat3 or the parental pCDNA1 vector, together with pRSV β-gal as an internal standard, and tested for basal and IL-6-induced luciferase expression. (B) Stat3 transactivation of C/EBPδ promoter mutants. The indicated deletion and point mutants (Fig. ​(Fig.33 and ​and4)4) were cotransfected with the Stat3 expression vector into Hep3B cells and tested for basal and IL-6-inducible luciferase expression. (C) Stat3 transactivates a heterologous promoter containing the C/EBPδ APRE. The indicated TK promoter-luciferase reporter constructs (Fig. ​(Fig.8)8) were cotransfected with the Stat3 expression plasmid into Hep3B cells and tested for basal and IL-6-inducible expression. The cell extracts were assayed for luciferase and β-galactosidase activities as described in Fig. ​Fig.3.3. The values represent the averages of three to six independent experiments.

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: Stat3 mediates IL-6-induced expression from the C/EBPδ promoter. (A) Stat3 but not Stat1 transactivates the C/EBPδ promoter. The (−127)-Luc construct was cotransfected into Hep3B cells with expression vectors for Stat1 or Stat3 or the parental pCDNA1 vector, together with pRSV β-gal as an internal standard, and tested for basal and IL-6-induced luciferase expression. (B) Stat3 transactivation of C/EBPδ promoter mutants. The indicated deletion and point mutants (Fig. ​(Fig.33 and ​and4)4) were cotransfected with the Stat3 expression vector into Hep3B cells and tested for basal and IL-6-inducible luciferase expression. (C) Stat3 transactivates a heterologous promoter containing the C/EBPδ APRE. The indicated TK promoter-luciferase reporter constructs (Fig. ​(Fig.8)8) were cotransfected with the Stat3 expression plasmid into Hep3B cells and tested for basal and IL-6-inducible expression. The cell extracts were assayed for luciferase and β-galactosidase activities as described in Fig. ​Fig.3.3. The values represent the averages of three to six independent experiments.

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Expressing, Construct, Plasmid Preparation, Luciferase

Sequences and Stat binding properties of the C/EBPδ APRE and several known SBEs

Journal:

Article Title: Interleukin-6-Specific Activation of the C/EBP? Gene in Hepatocytes Is Mediated by Stat3 and Sp1

doi:

Figure Lengend Snippet: Sequences and Stat binding properties of the C/EBPδ APRE and several known SBEs

Article Snippet: The following antibodies were purchased from Santa Cruz Biotechnology, Inc.: Stat1 p84/p91 (E-23), Stat3 (C-20), Sp1 (PEP2), and normal rabbit immunoglobulin G (normal rabbit serum [NRS]).

Techniques: Binding Assay

( A ) The knockdown expression of STAT3 and pSTAT3 was confirmed by WB in MCF7 cells. GAPDH was used as an internal control. ( B ) MTS assay was used to detect the effect of STAT3 knockdown on proliferation in MCF7 cells. * P < 0.05. ( C and D ) Scratch assay was performed to evaluate the effect of STAT3 knockdown on cell migration. * P < 0.05. ( E ) Transfectants of STAT3 and vector control in MCF7 cells were identified by WB. More abundant STAT3 was detected after STAT3 transfection compared with the control vector transfection. ( F ) MTS assay was used to detect the effect of STAT3 overexpression on proliferation in MCF7 cells.* P < 0.05. ( G and H ) Scratch assay was performed to evaluate the effect of STAT3 overexpression on cell migration. * P < 0.05.

Journal: Oncotarget

Article Title: Cystathionine- γ-lyase promotes process of breast cancer in association with STAT3 signaling pathway

doi: 10.18632/oncotarget.20057

Figure Lengend Snippet: ( A ) The knockdown expression of STAT3 and pSTAT3 was confirmed by WB in MCF7 cells. GAPDH was used as an internal control. ( B ) MTS assay was used to detect the effect of STAT3 knockdown on proliferation in MCF7 cells. * P < 0.05. ( C and D ) Scratch assay was performed to evaluate the effect of STAT3 knockdown on cell migration. * P < 0.05. ( E ) Transfectants of STAT3 and vector control in MCF7 cells were identified by WB. More abundant STAT3 was detected after STAT3 transfection compared with the control vector transfection. ( F ) MTS assay was used to detect the effect of STAT3 overexpression on proliferation in MCF7 cells.* P < 0.05. ( G and H ) Scratch assay was performed to evaluate the effect of STAT3 overexpression on cell migration. * P < 0.05.

Article Snippet: Primary antibodies were CSE rabbit polyclonal antibody (1:1000; Abcam, Cambridge, MA, USA), STAT3 rabbit monoclonal antibody (1:1000; Cell Signaling Technology, Danvers, MA, USA), and GAPDH mouse monoclonal antibody (1:1000, Biyuntian, China).

Techniques: Knockdown, Expressing, Control, MTS Assay, Wound Healing Assay, Migration, Plasmid Preparation, Transfection, Over Expression

( A ) qRT-PCR analysis of CSE and STAT3 mRNA levels in breast cancer tissues and adjacent non-tumor tissues. * P < 0.05 vs non-tumor tissues. ( B and C ) WB detection and quantitative analysis of CSE and STAT3 protein levels in breast cancer tissues and adjacent non-tumor tissues.* P < 0.05 vs non-tumor tissues. ( D ) qRT-PCR analysis of CSE and STAT3 mRNA levels in MCF7 cells and mammary epithelial MCF 10A cells. * P < 0.05 vs MCF10A cells. ( E and F ) WB and quantitative analysis of CSE and STAT3 protein levels in MCF7 cells and mammary epithelial MCF 10A cells. ( G – J ) Effect of STAT3 knockdown by RNAi on CSE mRNA, protein and H 2 S level in MCF7 cell line by qRT-PCR, WB and methylene blue assays. Error bars indicate s.d. ( n = 3). * P < 0.05.

Journal: Oncotarget

Article Title: Cystathionine- γ-lyase promotes process of breast cancer in association with STAT3 signaling pathway

doi: 10.18632/oncotarget.20057

Figure Lengend Snippet: ( A ) qRT-PCR analysis of CSE and STAT3 mRNA levels in breast cancer tissues and adjacent non-tumor tissues. * P < 0.05 vs non-tumor tissues. ( B and C ) WB detection and quantitative analysis of CSE and STAT3 protein levels in breast cancer tissues and adjacent non-tumor tissues.* P < 0.05 vs non-tumor tissues. ( D ) qRT-PCR analysis of CSE and STAT3 mRNA levels in MCF7 cells and mammary epithelial MCF 10A cells. * P < 0.05 vs MCF10A cells. ( E and F ) WB and quantitative analysis of CSE and STAT3 protein levels in MCF7 cells and mammary epithelial MCF 10A cells. ( G – J ) Effect of STAT3 knockdown by RNAi on CSE mRNA, protein and H 2 S level in MCF7 cell line by qRT-PCR, WB and methylene blue assays. Error bars indicate s.d. ( n = 3). * P < 0.05.

Article Snippet: Primary antibodies were CSE rabbit polyclonal antibody (1:1000; Abcam, Cambridge, MA, USA), STAT3 rabbit monoclonal antibody (1:1000; Cell Signaling Technology, Danvers, MA, USA), and GAPDH mouse monoclonal antibody (1:1000, Biyuntian, China).

Techniques: Quantitative RT-PCR, Knockdown

( A ) The five different regions of the CSE promoter were constructed into luciferase reporter. The possible binding sites of STAT3 in CSE promoter region are underlined with bold font; TSS, transcription start site. ( B ) STAT3 directly targets CSE. A luciferase reporter linked with the full-length native promoter of CSE was used for the luciferase reporter assay in 293T cells. Results were normalized with internal controls and presented as averages with SD from three experiments. ( C ) Different partial regions of CSE promoter were analyzed by luciferase reporter assay. Luciferase reporters linked with partial native promoter regions of CSE were used for the luciferase reporter assay in 293T cells. WB analysis of STAT3 expression was performed to exclude that the differences in transcriptional activity reflect changes in expression. The STAT3-binding region in CSE promoter should be at −504 to −286 according to the luciferase reporter assay results of the five different CSE-luciferase reporters. According to the binding sites predicted by Jaspar, the direct binding sites is likely located at CTGATGAGAA (−464 to −454) of the CSE promoter region. ( D ) The effect of STAT3 on human wild-type and deleted CSE promoter activity in 293T cells. CTGATGAGAA is deleted in CSE-luciferase-4. Error bars indicate s.d. ( n = 3). * P < 0.05 compared with Sc siRNA group; # P < 0.05 compared with CSE siRNA group.

Journal: Oncotarget

Article Title: Cystathionine- γ-lyase promotes process of breast cancer in association with STAT3 signaling pathway

doi: 10.18632/oncotarget.20057

Figure Lengend Snippet: ( A ) The five different regions of the CSE promoter were constructed into luciferase reporter. The possible binding sites of STAT3 in CSE promoter region are underlined with bold font; TSS, transcription start site. ( B ) STAT3 directly targets CSE. A luciferase reporter linked with the full-length native promoter of CSE was used for the luciferase reporter assay in 293T cells. Results were normalized with internal controls and presented as averages with SD from three experiments. ( C ) Different partial regions of CSE promoter were analyzed by luciferase reporter assay. Luciferase reporters linked with partial native promoter regions of CSE were used for the luciferase reporter assay in 293T cells. WB analysis of STAT3 expression was performed to exclude that the differences in transcriptional activity reflect changes in expression. The STAT3-binding region in CSE promoter should be at −504 to −286 according to the luciferase reporter assay results of the five different CSE-luciferase reporters. According to the binding sites predicted by Jaspar, the direct binding sites is likely located at CTGATGAGAA (−464 to −454) of the CSE promoter region. ( D ) The effect of STAT3 on human wild-type and deleted CSE promoter activity in 293T cells. CTGATGAGAA is deleted in CSE-luciferase-4. Error bars indicate s.d. ( n = 3). * P < 0.05 compared with Sc siRNA group; # P < 0.05 compared with CSE siRNA group.

Article Snippet: Primary antibodies were CSE rabbit polyclonal antibody (1:1000; Abcam, Cambridge, MA, USA), STAT3 rabbit monoclonal antibody (1:1000; Cell Signaling Technology, Danvers, MA, USA), and GAPDH mouse monoclonal antibody (1:1000, Biyuntian, China).

Techniques: Construct, Luciferase, Binding Assay, Reporter Assay, Expressing, Activity Assay

( A ) WB analysis of STAT3 and pSTAT3 protein levels in CSE overexpressed and /or down-regulated MCF7 cells. ( B ) Quantitative analysis of STAT3 and pSTAT3 protein levels in CSE overexpressed and /or down-regulated MCF7 cells. The results indicated that CSE reversely regulates STAT3 protein levels.

Journal: Oncotarget

Article Title: Cystathionine- γ-lyase promotes process of breast cancer in association with STAT3 signaling pathway

doi: 10.18632/oncotarget.20057

Figure Lengend Snippet: ( A ) WB analysis of STAT3 and pSTAT3 protein levels in CSE overexpressed and /or down-regulated MCF7 cells. ( B ) Quantitative analysis of STAT3 and pSTAT3 protein levels in CSE overexpressed and /or down-regulated MCF7 cells. The results indicated that CSE reversely regulates STAT3 protein levels.

Article Snippet: Primary antibodies were CSE rabbit polyclonal antibody (1:1000; Abcam, Cambridge, MA, USA), STAT3 rabbit monoclonal antibody (1:1000; Cell Signaling Technology, Danvers, MA, USA), and GAPDH mouse monoclonal antibody (1:1000, Biyuntian, China).

Techniques:

STAT3 and CSE interaction schematic diagram

Journal: Oncotarget

Article Title: Cystathionine- γ-lyase promotes process of breast cancer in association with STAT3 signaling pathway

doi: 10.18632/oncotarget.20057

Figure Lengend Snippet: STAT3 and CSE interaction schematic diagram

Article Snippet: Primary antibodies were CSE rabbit polyclonal antibody (1:1000; Abcam, Cambridge, MA, USA), STAT3 rabbit monoclonal antibody (1:1000; Cell Signaling Technology, Danvers, MA, USA), and GAPDH mouse monoclonal antibody (1:1000, Biyuntian, China).

Techniques:

Phenotypic effects of dysregulated CISH in OSCC cell lines. (A) Western blot analysis of the STAT3, 5 and their phosphorylation form after transfection of control vector (Vec) or CISH expression vector (CISH) for 48 h in SAS and SCC-4 cells. GAPDH was used as protein loading control. Numerical values for protein band intensities are shown below the gels. The values were quantitated by densitometry and normalized to GAPDH. (B) The effect of CISH on the transcriptional activity of the construct containing the STAT3 binding sequence. The relative luciferase activities are the ratios of Renilla luciferase normalized to the vector alone control. (C) Migration assay following CISH overexpression for 24 h using Matrigel non-coated Boyden chamber assay in SAS and SCC-4 cells. (D) Invasion assay following CISH overexpression for 24 h using Matrigel coated Boyden chamber assay in SAS and SCC-4 cells. (E) CCL3, CCL5 and IL-1β levels in cultured medium of CISH overexpression SAS and SCC-4 cells measured by ELISA (compared with Vec control). (F) Western blot analysis of the CISH, COX-2 and iNOS after transfection of CISH for 48 h in SAS and SCC-4 cells. GAPDH was used as protein loading control. All data are represented as mean ± SD; **, p < 0.01; ***, p < 0.001.

Journal: Neoplasia (New York, N.Y.)

Article Title: MiR-944/CISH mediated inflammation via STAT3 is involved in oral cancer malignance by cigarette smoking

doi: 10.1016/j.neo.2020.08.005

Figure Lengend Snippet: Phenotypic effects of dysregulated CISH in OSCC cell lines. (A) Western blot analysis of the STAT3, 5 and their phosphorylation form after transfection of control vector (Vec) or CISH expression vector (CISH) for 48 h in SAS and SCC-4 cells. GAPDH was used as protein loading control. Numerical values for protein band intensities are shown below the gels. The values were quantitated by densitometry and normalized to GAPDH. (B) The effect of CISH on the transcriptional activity of the construct containing the STAT3 binding sequence. The relative luciferase activities are the ratios of Renilla luciferase normalized to the vector alone control. (C) Migration assay following CISH overexpression for 24 h using Matrigel non-coated Boyden chamber assay in SAS and SCC-4 cells. (D) Invasion assay following CISH overexpression for 24 h using Matrigel coated Boyden chamber assay in SAS and SCC-4 cells. (E) CCL3, CCL5 and IL-1β levels in cultured medium of CISH overexpression SAS and SCC-4 cells measured by ELISA (compared with Vec control). (F) Western blot analysis of the CISH, COX-2 and iNOS after transfection of CISH for 48 h in SAS and SCC-4 cells. GAPDH was used as protein loading control. All data are represented as mean ± SD; **, p < 0.01; ***, p < 0.001.

Article Snippet: The membranes were probed with specific antibodies against CISH (#8731, Cell signaling, Danvers, MA), STAT3 (#610189, BD Biosciences, NJ), phospho-STAT3 (p-STAT3, Tyr 705 ) (#9131, Cell signaling), STAT5 (#25656, Cell signaling), phospho-STAT3 (p-STAT5, Tyr 694 ) (#9359, Cell signaling), COX-2 (#12282, Cell signaling), and iNOS (ab204017, Abcam, Cambridge, MA).

Techniques: Western Blot, Phospho-proteomics, Transfection, Control, Plasmid Preparation, Expressing, Activity Assay, Construct, Binding Assay, Sequencing, Luciferase, Migration, Over Expression, Boyden Chamber Assay, Invasion Assay, Cell Culture, Enzyme-linked Immunosorbent Assay

CISH is a direct target of miR-944. (A) Flow chat of predicted miRNA which targets CISH 3′-UTR using two independent algorithms (microRNA.org and TargetScan) combined with our patients’ miRNA array data (GSE45238). (B) Western blot analysis of CISH protein after transfection of miR-944 mimics (PM) with 30 nM for 48 h in OEC-M1 and SCC-25 cells. (C) Schematic representation of the putative miR-944 binding sequence in the 3′-UTR of CISH with wild-type form (CISH 3′UTR WT) and mutant form (CISH 3′UTR Mut). The mutated nucleotides are labeled with underline. (D) Luciferase activity assays were performed after OEC-M1 and SCC-25 cells transfected with luciferase vectors containing the wide-type or mutant CISH 3′-UTR, in response to miR-944 over-expression. The relative luciferase activity of each sample is measured at 48 h after transfection and normalized to Renilla luciferase activity. (E) Correlation analysis of miR-944 and CISH in human OSCC patients ( n = 33) by qRT-PCR analysis. Western blot analysis of the CISH, STAT3 and phosphor-STAT3 after transfection of miR-944 mimics (PM) (F) or miR-944 inhibitors (AM) (G) with indicated concentration for 48 h in OEC-M1 and SCC-25 cells. All data are presented as mean ± SD; ***, p < 0.001 versus scramble control (NC). GAPDH was used as protein loading control. Numerical values for protein band intensities are shown below the gels. The values were quantitated by densitometry and normalized to GAPDH.

Journal: Neoplasia (New York, N.Y.)

Article Title: MiR-944/CISH mediated inflammation via STAT3 is involved in oral cancer malignance by cigarette smoking

doi: 10.1016/j.neo.2020.08.005

Figure Lengend Snippet: CISH is a direct target of miR-944. (A) Flow chat of predicted miRNA which targets CISH 3′-UTR using two independent algorithms (microRNA.org and TargetScan) combined with our patients’ miRNA array data (GSE45238). (B) Western blot analysis of CISH protein after transfection of miR-944 mimics (PM) with 30 nM for 48 h in OEC-M1 and SCC-25 cells. (C) Schematic representation of the putative miR-944 binding sequence in the 3′-UTR of CISH with wild-type form (CISH 3′UTR WT) and mutant form (CISH 3′UTR Mut). The mutated nucleotides are labeled with underline. (D) Luciferase activity assays were performed after OEC-M1 and SCC-25 cells transfected with luciferase vectors containing the wide-type or mutant CISH 3′-UTR, in response to miR-944 over-expression. The relative luciferase activity of each sample is measured at 48 h after transfection and normalized to Renilla luciferase activity. (E) Correlation analysis of miR-944 and CISH in human OSCC patients ( n = 33) by qRT-PCR analysis. Western blot analysis of the CISH, STAT3 and phosphor-STAT3 after transfection of miR-944 mimics (PM) (F) or miR-944 inhibitors (AM) (G) with indicated concentration for 48 h in OEC-M1 and SCC-25 cells. All data are presented as mean ± SD; ***, p < 0.001 versus scramble control (NC). GAPDH was used as protein loading control. Numerical values for protein band intensities are shown below the gels. The values were quantitated by densitometry and normalized to GAPDH.

Article Snippet: The membranes were probed with specific antibodies against CISH (#8731, Cell signaling, Danvers, MA), STAT3 (#610189, BD Biosciences, NJ), phospho-STAT3 (p-STAT3, Tyr 705 ) (#9131, Cell signaling), STAT5 (#25656, Cell signaling), phospho-STAT3 (p-STAT5, Tyr 694 ) (#9359, Cell signaling), COX-2 (#12282, Cell signaling), and iNOS (ab204017, Abcam, Cambridge, MA).

Techniques: Western Blot, Transfection, Binding Assay, Sequencing, Mutagenesis, Labeling, Luciferase, Activity Assay, Over Expression, Quantitative RT-PCR, Concentration Assay, Control

miR-944 regulates OSCC cell functions through targeting CISH. OSCC cells were transfected with miR-944 mimics (PM) or scramble control (NC) for 24 h and then transfected with CISH expression vector without 3′-UTR (pCDNA3.1-CISH) or control vector (pCDNA3.1) for another 24 h. Under this condition, the level of CISH, STAT3 and phosphor-STAT3 were determined in OEC-M1 and SCC-25 cells by western blotting (A). The RNA level of COX-2 and iNOS (B), protein level of CCL3, CCL5 and IL-1β levels in cultured medium (C), migration ability (D), and invasion ability (E) were measured by qRT-PCR, ELISA and transwell assays in OEC-M1 cells. All data are presented as mean ± SD; **, p < 0.01; ***, p < 0.001 versus scramble control (NC). GAPDH was used as protein loading control. Numerical values for protein band intensities are shown below the gels. The values were quantitated by densitometry and normalized to GAPDH.

Journal: Neoplasia (New York, N.Y.)

Article Title: MiR-944/CISH mediated inflammation via STAT3 is involved in oral cancer malignance by cigarette smoking

doi: 10.1016/j.neo.2020.08.005

Figure Lengend Snippet: miR-944 regulates OSCC cell functions through targeting CISH. OSCC cells were transfected with miR-944 mimics (PM) or scramble control (NC) for 24 h and then transfected with CISH expression vector without 3′-UTR (pCDNA3.1-CISH) or control vector (pCDNA3.1) for another 24 h. Under this condition, the level of CISH, STAT3 and phosphor-STAT3 were determined in OEC-M1 and SCC-25 cells by western blotting (A). The RNA level of COX-2 and iNOS (B), protein level of CCL3, CCL5 and IL-1β levels in cultured medium (C), migration ability (D), and invasion ability (E) were measured by qRT-PCR, ELISA and transwell assays in OEC-M1 cells. All data are presented as mean ± SD; **, p < 0.01; ***, p < 0.001 versus scramble control (NC). GAPDH was used as protein loading control. Numerical values for protein band intensities are shown below the gels. The values were quantitated by densitometry and normalized to GAPDH.

Article Snippet: The membranes were probed with specific antibodies against CISH (#8731, Cell signaling, Danvers, MA), STAT3 (#610189, BD Biosciences, NJ), phospho-STAT3 (p-STAT3, Tyr 705 ) (#9131, Cell signaling), STAT5 (#25656, Cell signaling), phospho-STAT3 (p-STAT5, Tyr 694 ) (#9359, Cell signaling), COX-2 (#12282, Cell signaling), and iNOS (ab204017, Abcam, Cambridge, MA).

Techniques: Transfection, Control, Expressing, Plasmid Preparation, Western Blot, Cell Culture, Migration, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

NNK exposure induces miR-944 expression. (A) OEC-M1 and SCC-25 cells were treated with NNK (10–40 µM) for 72 h, and the miR-944 expression level was measured by qRT-PCR analysis. (B) OEC-M1 and SCC-25 cells were treated with 20 µM of NNK for indicated time (24–72 h), and the miR-944 expression level was measured by qRT-PCR analysis. (C) Luciferase activity assays were performed after OEC-M1 and SCC-25 cells transfected with luciferase vectors containing the wide-type or mutant CISH 3′-UTR, in response to DMSO control or 20 µM of NNK treatment. The relative luciferase activity of each sample is measured at 72 h after transfection and normalized to Renilla luciferase activity. OEC-M1 and SCC-25 cells were transfected with miR-944 inhibitors (AM) for 12 h, and followed by 20 µM of NNK treatment for another 72 h. Under this condition, the expression level of miR-944 was determined by qRT-PCR analysis (D), and the protein level of CISH, STAT3, phosphor-STAT3 and GAPDH were determined by western blot analysis (E). All data are presented as mean ± SD; *, p < 0.05; **, p < 0.01; ***, p < 0.001. Numerical values for protein band intensities are shown below the gels. The values were quantitated by densitometry and normalized to GAPDH.

Journal: Neoplasia (New York, N.Y.)

Article Title: MiR-944/CISH mediated inflammation via STAT3 is involved in oral cancer malignance by cigarette smoking

doi: 10.1016/j.neo.2020.08.005

Figure Lengend Snippet: NNK exposure induces miR-944 expression. (A) OEC-M1 and SCC-25 cells were treated with NNK (10–40 µM) for 72 h, and the miR-944 expression level was measured by qRT-PCR analysis. (B) OEC-M1 and SCC-25 cells were treated with 20 µM of NNK for indicated time (24–72 h), and the miR-944 expression level was measured by qRT-PCR analysis. (C) Luciferase activity assays were performed after OEC-M1 and SCC-25 cells transfected with luciferase vectors containing the wide-type or mutant CISH 3′-UTR, in response to DMSO control or 20 µM of NNK treatment. The relative luciferase activity of each sample is measured at 72 h after transfection and normalized to Renilla luciferase activity. OEC-M1 and SCC-25 cells were transfected with miR-944 inhibitors (AM) for 12 h, and followed by 20 µM of NNK treatment for another 72 h. Under this condition, the expression level of miR-944 was determined by qRT-PCR analysis (D), and the protein level of CISH, STAT3, phosphor-STAT3 and GAPDH were determined by western blot analysis (E). All data are presented as mean ± SD; *, p < 0.05; **, p < 0.01; ***, p < 0.001. Numerical values for protein band intensities are shown below the gels. The values were quantitated by densitometry and normalized to GAPDH.

Article Snippet: The membranes were probed with specific antibodies against CISH (#8731, Cell signaling, Danvers, MA), STAT3 (#610189, BD Biosciences, NJ), phospho-STAT3 (p-STAT3, Tyr 705 ) (#9131, Cell signaling), STAT5 (#25656, Cell signaling), phospho-STAT3 (p-STAT5, Tyr 694 ) (#9359, Cell signaling), COX-2 (#12282, Cell signaling), and iNOS (ab204017, Abcam, Cambridge, MA).

Techniques: Expressing, Quantitative RT-PCR, Luciferase, Activity Assay, Transfection, Mutagenesis, Control, Western Blot

The effects of NNK on the STAT3-mediated pro-inflammation genes. OEC-M1 and SCC-25 cells were transfected with miR-944 inhibitors (AM) for 12 h, and followed by 20 µM of NNK treatment for another 72 h. The RNA level of COX-2 and iNOS in cells (A), protein level of CCL3, CCL5 and IL-1β in cultured medium (B) were measured by qRT-PCR or ELISA. (C) Migration and invasion ability were measured by transwell assays in OEC-M1 and SCC-25 cells. (D) OEC-M1 and SCC-25 cells were treated with 20 µM of NNK for 72 h, and the TP63 expression level was measured by qRT-PCR analysis. (E) Correlation analysis of miR-944 and TP63 in human OSCC patients (n = 33) by qRT-PCR analysis. (F) Proposed model for comprehensive NNK-induced upregulation of miR-944 in stimulating STAT3 activation and pro-inflammatory genes expression through suppression of CISH. All data are represented as mean ± SD; **, p < 0.01; ***, p < 0.001.

Journal: Neoplasia (New York, N.Y.)

Article Title: MiR-944/CISH mediated inflammation via STAT3 is involved in oral cancer malignance by cigarette smoking

doi: 10.1016/j.neo.2020.08.005

Figure Lengend Snippet: The effects of NNK on the STAT3-mediated pro-inflammation genes. OEC-M1 and SCC-25 cells were transfected with miR-944 inhibitors (AM) for 12 h, and followed by 20 µM of NNK treatment for another 72 h. The RNA level of COX-2 and iNOS in cells (A), protein level of CCL3, CCL5 and IL-1β in cultured medium (B) were measured by qRT-PCR or ELISA. (C) Migration and invasion ability were measured by transwell assays in OEC-M1 and SCC-25 cells. (D) OEC-M1 and SCC-25 cells were treated with 20 µM of NNK for 72 h, and the TP63 expression level was measured by qRT-PCR analysis. (E) Correlation analysis of miR-944 and TP63 in human OSCC patients (n = 33) by qRT-PCR analysis. (F) Proposed model for comprehensive NNK-induced upregulation of miR-944 in stimulating STAT3 activation and pro-inflammatory genes expression through suppression of CISH. All data are represented as mean ± SD; **, p < 0.01; ***, p < 0.001.

Article Snippet: The membranes were probed with specific antibodies against CISH (#8731, Cell signaling, Danvers, MA), STAT3 (#610189, BD Biosciences, NJ), phospho-STAT3 (p-STAT3, Tyr 705 ) (#9131, Cell signaling), STAT5 (#25656, Cell signaling), phospho-STAT3 (p-STAT5, Tyr 694 ) (#9359, Cell signaling), COX-2 (#12282, Cell signaling), and iNOS (ab204017, Abcam, Cambridge, MA).

Techniques: Transfection, Cell Culture, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Migration, Expressing, Activation Assay

PRMT5 potentiates STAT3 activation via Smad7. A) PRMT5 depletion dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shPRMT5‐1 or shPRMT5‐2 or Control (shCtrl) were harvested and analyzed by using western blotting with indicated antibodies. B) Knockdown of PRMT5 attenuates IL‐6‐induced STAT3 phosphorylation in MCF10A cells. MCF10A cells were transfected with 40 pm siRNA against PRMT5. 36 h later, cells were treated with IL‐6 (10 ng mL −1 ) for the indicated time and harvested for western blotting analysis with appropriate antibodies. C) PRMT5 inhibition attenuates endogenous activation of STAT3 in H358 cells. H358 cells were treated with 20 × 10 −6 m of PRMT5 inhibitors EPZ015666 or GSK591 for the indicated time. Cell lysates were collected and subject to western blotting analysis. SDMA indicates global arginine di‐methylation. D) Smad7 potentiates STAT3 activation in A549 cells. A549 cells stably expressing FLAG‐GFP or FLAG‐Smad7 were harvested and subject to Western blotting analysis using appropriate antibodies. E) Stable knockdown of Smad7 dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shSmad7 or shCtrl were harvested and subject to western blotting analysis using appropriate antibodies. F) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF7 cells. Cells were transfected with siSmad7 (40 pm) and treated with IL‐6 (10 ng mL −1 ) for the indicated time. Cells were harvested and analyzed by western blotting with appropriate antibodies. G) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF10A cells. Cell transfection, treatment, and Western blotting were done as described in Panel F. H) PRMT5 potentiates STAT3 activation dependent of Smad7. MCF10A cells were transduced with lentiviral particles expressing HA‐PRMT5 or HA‐G367A/R368A. After 24 h, cells were transfected with 40 pm siSmad7. 12 h later, cells were stimulated with IL‐6 (2 ng mL −1 ) for the indicated time. Cell lysates were harvested and subject to Western blotting analysis using appropriate antibodies.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: PRMT5 potentiates STAT3 activation via Smad7. A) PRMT5 depletion dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shPRMT5‐1 or shPRMT5‐2 or Control (shCtrl) were harvested and analyzed by using western blotting with indicated antibodies. B) Knockdown of PRMT5 attenuates IL‐6‐induced STAT3 phosphorylation in MCF10A cells. MCF10A cells were transfected with 40 pm siRNA against PRMT5. 36 h later, cells were treated with IL‐6 (10 ng mL −1 ) for the indicated time and harvested for western blotting analysis with appropriate antibodies. C) PRMT5 inhibition attenuates endogenous activation of STAT3 in H358 cells. H358 cells were treated with 20 × 10 −6 m of PRMT5 inhibitors EPZ015666 or GSK591 for the indicated time. Cell lysates were collected and subject to western blotting analysis. SDMA indicates global arginine di‐methylation. D) Smad7 potentiates STAT3 activation in A549 cells. A549 cells stably expressing FLAG‐GFP or FLAG‐Smad7 were harvested and subject to Western blotting analysis using appropriate antibodies. E) Stable knockdown of Smad7 dampens endogenous STAT3 activation in A549 cells. A549 cells stably expressing shSmad7 or shCtrl were harvested and subject to western blotting analysis using appropriate antibodies. F) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF7 cells. Cells were transfected with siSmad7 (40 pm) and treated with IL‐6 (10 ng mL −1 ) for the indicated time. Cells were harvested and analyzed by western blotting with appropriate antibodies. G) Smad7 depletion dampens IL‐6‐induced STAT3 activation in MCF10A cells. Cell transfection, treatment, and Western blotting were done as described in Panel F. H) PRMT5 potentiates STAT3 activation dependent of Smad7. MCF10A cells were transduced with lentiviral particles expressing HA‐PRMT5 or HA‐G367A/R368A. After 24 h, cells were transfected with 40 pm siSmad7. 12 h later, cells were stimulated with IL‐6 (2 ng mL −1 ) for the indicated time. Cell lysates were harvested and subject to Western blotting analysis using appropriate antibodies.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Activation Assay, Stable Transfection, Expressing, Control, Western Blot, Knockdown, Phospho-proteomics, Transfection, Inhibition, Methylation, Transduction

PRMT5 methylates Smad7 on R57. A) PRMT5 methylates Smad7. HEK293T cells were transfected with expression plasmids carrying MYC‐PRMT5/MEP50 and an SFB‐tagged construct, including gp130, JAK2, STAT3, Smad7, SHP2, and SOCS3. Cell lysates were harvested and precipitated with streptavidin beads. The retrieved complexes and input were analyzed by Western blotting with indicated antibodies. B) PRMT5 methylates the R57 residue on Smad7. HEK293T cells were transfected with MYC‐PRMT5/MEP50 and an SFB‐tagged Smad7 construct, i.e., wildtype Smad7 (WT) or a R‐to‐K substitution of Smad7 as indicated above the blots. Cell lysate was precipitated with streptavidin beads. Arginine di‐methylation of Smad7 was detected by Western blotting analysis. C) Mass spectrum of Smad7 Arg‐57 dimethylated peptide. Mass spectrometry identified Arg‐57 dimethylation of Smad7 in HEK293T cells expressing MYC‐PRMT5/MEP50 and SFB‐Smad7. Mass spectrometry profile of Smad7 sequence covering residue 47–64 is shown, and the dimethylated arginine side chains are indicated. D) PRMT5/MEP50 methylate Smad7, but not the R57K mutant. HEK293T cells were transfected MYC‐PRMT5/MEP50 and SFB‐Smad7 or Smad7 R57K mutant for 36 h. Cell lysates were harvested and immunoprecipitated with SYM10 antibody. The immunocomplexes and inputs were analyzed by Western blotting with indicated antibodies. E) PRMT5 methylates Smad7 in vitro. MYC‐PRMT5 or MYC‐G367A/R368A together with MYC‐MEP50 were immunopurified using anti‐MYC antibody from transfected HEK293T cells. Purified recombinant GST‐Smad7, GST‐Smad7 R57K mutant, and GST‐Smad4 were produced in E. coli . GST proteins and MYC‐PRMT5/MEP50 proteins were incubated in the presence of S‐adenosyl‐methionine to allow methylation reaction. Dimethylated Smad7 on R57 was detected by using Western blotting analysis.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: PRMT5 methylates Smad7 on R57. A) PRMT5 methylates Smad7. HEK293T cells were transfected with expression plasmids carrying MYC‐PRMT5/MEP50 and an SFB‐tagged construct, including gp130, JAK2, STAT3, Smad7, SHP2, and SOCS3. Cell lysates were harvested and precipitated with streptavidin beads. The retrieved complexes and input were analyzed by Western blotting with indicated antibodies. B) PRMT5 methylates the R57 residue on Smad7. HEK293T cells were transfected with MYC‐PRMT5/MEP50 and an SFB‐tagged Smad7 construct, i.e., wildtype Smad7 (WT) or a R‐to‐K substitution of Smad7 as indicated above the blots. Cell lysate was precipitated with streptavidin beads. Arginine di‐methylation of Smad7 was detected by Western blotting analysis. C) Mass spectrum of Smad7 Arg‐57 dimethylated peptide. Mass spectrometry identified Arg‐57 dimethylation of Smad7 in HEK293T cells expressing MYC‐PRMT5/MEP50 and SFB‐Smad7. Mass spectrometry profile of Smad7 sequence covering residue 47–64 is shown, and the dimethylated arginine side chains are indicated. D) PRMT5/MEP50 methylate Smad7, but not the R57K mutant. HEK293T cells were transfected MYC‐PRMT5/MEP50 and SFB‐Smad7 or Smad7 R57K mutant for 36 h. Cell lysates were harvested and immunoprecipitated with SYM10 antibody. The immunocomplexes and inputs were analyzed by Western blotting with indicated antibodies. E) PRMT5 methylates Smad7 in vitro. MYC‐PRMT5 or MYC‐G367A/R368A together with MYC‐MEP50 were immunopurified using anti‐MYC antibody from transfected HEK293T cells. Purified recombinant GST‐Smad7, GST‐Smad7 R57K mutant, and GST‐Smad4 were produced in E. coli . GST proteins and MYC‐PRMT5/MEP50 proteins were incubated in the presence of S‐adenosyl‐methionine to allow methylation reaction. Dimethylated Smad7 on R57 was detected by using Western blotting analysis.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Transfection, Expressing, Construct, Western Blot, Residue, Methylation, Mass Spectrometry, Sequencing, Mutagenesis, Immunoprecipitation, In Vitro, Purification, Recombinant, Produced, Incubation

Arg methylation enhances Smad7 binding to gp130. A) Smad7 methylation increases its association with gp130. HEK293T cells were transfected with SFB‐Smad7 or Smad7 R57K mutant and HA‐gp130, together with MYC‐PRMT5/MEP50. Cell lysates were harvested and immunoprecipitated with Streptavidin beads. Western blotting analysis was done with appropriate antibodies. B) PRMT5 depletion blocks Smad7 methylation and its interaction with endogenous gp130. A549 tet‐on cells expressing SFB‐Smad7 were cultured with or without 1 µg mL −1 Dox for 3 d and then transfected with 40 × 10 −12 m siPRMT5. Cell lysates were harvested and immunoprecipitated with streptavidin beads. Endogenous gp130 was detected from the immunoprecipitates by using Western blotting analysis. C) Methylated Smad7 binds more tightly to gp130. HEK293T cells were transfected with indicated expression plasmids for MYC‐PRMT5, MYC‐G367A/R368A, and MYC‐MEP50 as well as SFB‐Smad7 or SFB‐R57K. Dimethylated Smad7 was immunopurified using SYM10 antibody, while total Smad7 was retrieved using an‐FLAG antibody. Bacterially expressed GST‐gp130‐ICD was purified using glutathione‐sepharose and eluted with elution buffer (10 × 10 −3 m glutathione, pH 8.0). In the in vitro binding experiments for evaluating the Smad7‐gp130 interaction, recombinant GST‐gp130‐ICD was added to the immunopurified Smad7. gp130‐ICD binding to immobilized Smad7 was analyzed by using Western blotting. D) Unmethylatable Smad7 R57K mutant loses its ability to potentiate STAT3 activation. MCF10A tet‐on cells stably expressing SFB‐Smad7 or Smad7 R57K were induced with 10 ng mL −1 Dox for 3 d, and treated with indicated concentrations of IL‐6. Cell lysates were collected and subject to Western blotting analysis.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: Arg methylation enhances Smad7 binding to gp130. A) Smad7 methylation increases its association with gp130. HEK293T cells were transfected with SFB‐Smad7 or Smad7 R57K mutant and HA‐gp130, together with MYC‐PRMT5/MEP50. Cell lysates were harvested and immunoprecipitated with Streptavidin beads. Western blotting analysis was done with appropriate antibodies. B) PRMT5 depletion blocks Smad7 methylation and its interaction with endogenous gp130. A549 tet‐on cells expressing SFB‐Smad7 were cultured with or without 1 µg mL −1 Dox for 3 d and then transfected with 40 × 10 −12 m siPRMT5. Cell lysates were harvested and immunoprecipitated with streptavidin beads. Endogenous gp130 was detected from the immunoprecipitates by using Western blotting analysis. C) Methylated Smad7 binds more tightly to gp130. HEK293T cells were transfected with indicated expression plasmids for MYC‐PRMT5, MYC‐G367A/R368A, and MYC‐MEP50 as well as SFB‐Smad7 or SFB‐R57K. Dimethylated Smad7 was immunopurified using SYM10 antibody, while total Smad7 was retrieved using an‐FLAG antibody. Bacterially expressed GST‐gp130‐ICD was purified using glutathione‐sepharose and eluted with elution buffer (10 × 10 −3 m glutathione, pH 8.0). In the in vitro binding experiments for evaluating the Smad7‐gp130 interaction, recombinant GST‐gp130‐ICD was added to the immunopurified Smad7. gp130‐ICD binding to immobilized Smad7 was analyzed by using Western blotting. D) Unmethylatable Smad7 R57K mutant loses its ability to potentiate STAT3 activation. MCF10A tet‐on cells stably expressing SFB‐Smad7 or Smad7 R57K were induced with 10 ng mL −1 Dox for 3 d, and treated with indicated concentrations of IL‐6. Cell lysates were collected and subject to Western blotting analysis.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Methylation, Binding Assay, Transfection, Mutagenesis, Immunoprecipitation, Western Blot, Expressing, Cell Culture, Purification, In Vitro, Recombinant, Activation Assay, Stable Transfection

PRMT5 promotes STAT3 transcriptional and growth‐promoting responses. A) PRMT5 inhibition attenuates CDC25C expression in A549 cells. EPZ015666 or GSK591 (20 × 10 −6 m ) were added to A549 cells for 48 h. Cell lysates were harvested and analyzed by using qRT‐PCR to examine CDC25C mRNA levels. Data are shown as mean ± SD; n = 3. *** P < 0.001. B) PRMT5 inhibition attenuates CCNB1 expression in A549 cells. Cell treatment, harvest, and qRT‐PCR analysis were done as described in Panel A. Data are shown as mean ± SD; n = 3. *** P < 0.001. C) PRMT5 deficiency disables IL‐6/STAT3 responsiveness. GSEA showed that downregulated genes in PRMT5‐depleted A549 cells (shPRMT5‐2) were highly enriched in the IL‐6/STAT3 signaling gene set. Red, upregulated genes; blue, downregulated genes. NES = ‐1.73, FDR q value = 0.002. D) Heatmap showing expression levels (log 2 FPKM; left) and relative expression changes (log 2 (shPRMT5‐2/shCtrl); right) of the IL‐6/STAT3 signaling genes. E) Depletion of PRMT5 reduces DNA synthesis. A549 cells stably expressing shPRMT5‐1 or shPRMT5‐2 or Control (shCtrl) were subject to EdU staining to determine DNA incorporating rate (RiboBio),20x. F) Statistic analysis of the result in panel E. Data are shown as mean ± SD; n = 3. 0.01 < * P < 0.05. G) Inhibition of PRMT5 attenuates invasiveness in A549 cells. A549 cells were treated with PRMT5 inhibitors EPZ015666 or GSK591 (20 × 10 −6 m ) for 2 d, starved overnight in FBS‐free medium. 1 × 10 5 cells were plated in a transwell chamber and stained with crystal violet after 12 h. Purple color indicates crystal violet staining of the invaded cell population. H) PRMT5 depletion blocks colony formation. A549 stable cells were subject to crystal violet staining and photography.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: PRMT5 promotes STAT3 transcriptional and growth‐promoting responses. A) PRMT5 inhibition attenuates CDC25C expression in A549 cells. EPZ015666 or GSK591 (20 × 10 −6 m ) were added to A549 cells for 48 h. Cell lysates were harvested and analyzed by using qRT‐PCR to examine CDC25C mRNA levels. Data are shown as mean ± SD; n = 3. *** P < 0.001. B) PRMT5 inhibition attenuates CCNB1 expression in A549 cells. Cell treatment, harvest, and qRT‐PCR analysis were done as described in Panel A. Data are shown as mean ± SD; n = 3. *** P < 0.001. C) PRMT5 deficiency disables IL‐6/STAT3 responsiveness. GSEA showed that downregulated genes in PRMT5‐depleted A549 cells (shPRMT5‐2) were highly enriched in the IL‐6/STAT3 signaling gene set. Red, upregulated genes; blue, downregulated genes. NES = ‐1.73, FDR q value = 0.002. D) Heatmap showing expression levels (log 2 FPKM; left) and relative expression changes (log 2 (shPRMT5‐2/shCtrl); right) of the IL‐6/STAT3 signaling genes. E) Depletion of PRMT5 reduces DNA synthesis. A549 cells stably expressing shPRMT5‐1 or shPRMT5‐2 or Control (shCtrl) were subject to EdU staining to determine DNA incorporating rate (RiboBio),20x. F) Statistic analysis of the result in panel E. Data are shown as mean ± SD; n = 3. 0.01 < * P < 0.05. G) Inhibition of PRMT5 attenuates invasiveness in A549 cells. A549 cells were treated with PRMT5 inhibitors EPZ015666 or GSK591 (20 × 10 −6 m ) for 2 d, starved overnight in FBS‐free medium. 1 × 10 5 cells were plated in a transwell chamber and stained with crystal violet after 12 h. Purple color indicates crystal violet staining of the invaded cell population. H) PRMT5 depletion blocks colony formation. A549 stable cells were subject to crystal violet staining and photography.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Inhibition, Expressing, Quantitative RT-PCR, DNA Synthesis, Stable Transfection, Control, Staining

PRMT5 promotes lung tumorigenesis. A) Depletion of PRMT5 attenuates tumorigenesis. LLC cells stably expressing shControl or mouse sh‐mPRMT5‐1 or sh‐mPRMT5‐2 were subcutaneously injected into female nude mice. Ten days after implantation, tumors were dissected and photographed. B) Measurement of tumor weight in Panel A. Data are shown as mean ± SD; n = 5 for each group. 0.01 < * P < 0.05. C) PRMT5 depletion impairs STAT3 signaling in tumors. Tumor samples were analyzed by Western blotting to examine phosphorylated STAT3 (p‐STAT3) and STAT3 target gene products such as c‐Myc and Survivin. D) PRMT5 is highly expressed in nonsmall cell lung cancer tissues (NSCLC). NSCLC tissue microarray (Alenabio) was subject to immunohistochemistry (Servicebio) using PRMT5 antibody. E) Statistic analysis of IHC score in Panel D. Statistical analysis was performed using a two‐tailed Student's t ‐test. Data are shown as mean ± SD. Lung cancer samples = 45. Normal lung tissue samples = 55. *** P < 0.001. F) A working model for PRMT5‐mediated STAT3 activation.

Journal: Advanced Science

Article Title: PRMT5 Enables Robust STAT3 Activation via Arginine Symmetric Dimethylation of SMAD7

doi: 10.1002/advs.202003047

Figure Lengend Snippet: PRMT5 promotes lung tumorigenesis. A) Depletion of PRMT5 attenuates tumorigenesis. LLC cells stably expressing shControl or mouse sh‐mPRMT5‐1 or sh‐mPRMT5‐2 were subcutaneously injected into female nude mice. Ten days after implantation, tumors were dissected and photographed. B) Measurement of tumor weight in Panel A. Data are shown as mean ± SD; n = 5 for each group. 0.01 < * P < 0.05. C) PRMT5 depletion impairs STAT3 signaling in tumors. Tumor samples were analyzed by Western blotting to examine phosphorylated STAT3 (p‐STAT3) and STAT3 target gene products such as c‐Myc and Survivin. D) PRMT5 is highly expressed in nonsmall cell lung cancer tissues (NSCLC). NSCLC tissue microarray (Alenabio) was subject to immunohistochemistry (Servicebio) using PRMT5 antibody. E) Statistic analysis of IHC score in Panel D. Statistical analysis was performed using a two‐tailed Student's t ‐test. Data are shown as mean ± SD. Lung cancer samples = 45. Normal lung tissue samples = 55. *** P < 0.001. F) A working model for PRMT5‐mediated STAT3 activation.

Article Snippet: Antibodies and their commercial sources are as follows: PRMT5 (ab109451) and gp130 (ab202850) from Abcam; p‐STAT3 (9145), STAT3 (9139), HA (3724) and sdme‐RG (13222) from Cell Signaling Technology; SYM10 (07‐412) from Merck millipore; FLAG (F3165), β ‐actin (A5441), mouse IgG (I5381), and rabbit IgG(I5006) from Sigma‐Aldrich (USA); MYC (sc‐40) from Santa Cruz Biotechnology; Survivin (A19663) and c‐MYC (A1309) from Abclonal.

Techniques: Stable Transfection, Expressing, Injection, Western Blot, Microarray, Immunohistochemistry, Two Tailed Test, Activation Assay

Fig. 1. STAT3 reduced 6-OHDA neurotoxicity in N27 cell lines. Control N27 cells were examined in the absence (A) or presence (B) of 50 µM 6-OHDA for 24 h. N27 cells expressing caSTAT3 were examined in the absence (C) or presence (D) of 50 µM 6-OHDA for 24 h E) Graphical plot illustrating that caSTAT3 transfected N27 cells reduced percentage of cell deaths under 6-OHDA induced neurotoxicity. Three different batches of cell culture used. Result in mean ± SE. For each sample a minimum of 10,000 cells were recorded. The pink box represents the FVD + population of dead cells. The cells were double stained with FVD eFluor 660 and Annexin V-PE. The FVD-/Annexin V- population is regarded as normal healthy cells, while FVD-/AnnexinV + population is early apoptotic cells, and FVD+/AnnexinV+/- population represents necrotic/late apoptotic like cell death. Expression of caSTAT3 greatly reduced the percentage of dead cells 24 h after 6-OHDA treatment. F) Western blot analysis showed expression of phosphorylated STAT3 (pSTAT3) at Tyr705 (lane 3). An upregulation of pSTAT3 expression was found when compared to non-infected (lane 1) or GFP (lane 2) transfected N27 cell lysates. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Journal: Brain research

Article Title: STAT3 protects dopaminergic neurons against degeneration in animal model of Parkinson's disease.

doi: 10.1016/j.brainres.2023.148691

Figure Lengend Snippet: Fig. 1. STAT3 reduced 6-OHDA neurotoxicity in N27 cell lines. Control N27 cells were examined in the absence (A) or presence (B) of 50 µM 6-OHDA for 24 h. N27 cells expressing caSTAT3 were examined in the absence (C) or presence (D) of 50 µM 6-OHDA for 24 h E) Graphical plot illustrating that caSTAT3 transfected N27 cells reduced percentage of cell deaths under 6-OHDA induced neurotoxicity. Three different batches of cell culture used. Result in mean ± SE. For each sample a minimum of 10,000 cells were recorded. The pink box represents the FVD + population of dead cells. The cells were double stained with FVD eFluor 660 and Annexin V-PE. The FVD-/Annexin V- population is regarded as normal healthy cells, while FVD-/AnnexinV + population is early apoptotic cells, and FVD+/AnnexinV+/- population represents necrotic/late apoptotic like cell death. Expression of caSTAT3 greatly reduced the percentage of dead cells 24 h after 6-OHDA treatment. F) Western blot analysis showed expression of phosphorylated STAT3 (pSTAT3) at Tyr705 (lane 3). An upregulation of pSTAT3 expression was found when compared to non-infected (lane 1) or GFP (lane 2) transfected N27 cell lysates. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: Recombinant adeno-associated virus 2 (AAV2) carrying GFP or caRheb (kindly provided by Zhigang He, Harvard University, Boston, USA) was tagged with HA or caSTAT3 (pMXs-Stat3-C was a gift from Shinya Yamanaka (Addgene plasmid #13373) by helper virus-free system (Ayuso et al., 2010).

Techniques: Control, Expressing, Transfection, Cell Culture, Staining, Western Blot, Infection

Fig. 2. caSTAT3 attenuated 6-OHDA-induced mitochondrial dysfunction. Control fluorescence, caSTAT3-expressing, and caRheb-expressing N27 cells were plated on coverslips and treated with indicated concentrations of 6-OHDA (µM) for 24 hrs prior to imaging (A); cells were loaded with 0.05 nM MitoSOX Red. B) The mean fluorescence intensity (F580 nm) of multiple cells (6 – 50 per condition) was quantified and plotted ± S.E.M. Two-way analysis of variance (ANOVA, F (2, 14) = 9.646, p = 0.0023) indicates significantly decreased mitochondrial superoxide production in caRheb or caSTAT3-expressing cells treated with either 6-OHDA dose compared to control. Sidak post hoc values for individual data points ** p < 0.01, *** p < 0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Journal: Brain research

Article Title: STAT3 protects dopaminergic neurons against degeneration in animal model of Parkinson's disease.

doi: 10.1016/j.brainres.2023.148691

Figure Lengend Snippet: Fig. 2. caSTAT3 attenuated 6-OHDA-induced mitochondrial dysfunction. Control fluorescence, caSTAT3-expressing, and caRheb-expressing N27 cells were plated on coverslips and treated with indicated concentrations of 6-OHDA (µM) for 24 hrs prior to imaging (A); cells were loaded with 0.05 nM MitoSOX Red. B) The mean fluorescence intensity (F580 nm) of multiple cells (6 – 50 per condition) was quantified and plotted ± S.E.M. Two-way analysis of variance (ANOVA, F (2, 14) = 9.646, p = 0.0023) indicates significantly decreased mitochondrial superoxide production in caRheb or caSTAT3-expressing cells treated with either 6-OHDA dose compared to control. Sidak post hoc values for individual data points ** p < 0.01, *** p < 0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: Recombinant adeno-associated virus 2 (AAV2) carrying GFP or caRheb (kindly provided by Zhigang He, Harvard University, Boston, USA) was tagged with HA or caSTAT3 (pMXs-Stat3-C was a gift from Shinya Yamanaka (Addgene plasmid #13373) by helper virus-free system (Ayuso et al., 2010).

Techniques: Control, Fluorescence, Expressing, Imaging

Fig. 4. caSTAT3 protects dopaminergic neurons from 6-OHDA induced neurodegeneration. Data shows dopaminergic neuron survival 4 weeks after unilateral in jections of 6-OHDA in rats pre-injected with AAV/GFP (A,D), AAV/caSTAT3 (B,E,G) and AAV/caRheb (C,F) into the substantia nigra (SN). Coronal brain section (A,B, C) showing the extent of dopaminergic axon terminals with the striatum and the survival of dopaminergic neurons within the substantia nigra (D, E, F). Dramatic protection of striatal terminals and neurons is apparent in animals treated with either caSTAT3 (compare B & E to A & D, respectively) or caRheb (compare C & F to A & D, respectively). High magnification of TH + neurons from panel E shows neurons with a normal morphology (G). Quantitative analysis shows caRheb + caSTAT3, caSTAT3, or caRheb to statistically [ANOVA, F(3, 55) = 7.93, bonferroni post-hoc, p < 0.0001] preserve high density of dopaminergic nerve terminals within the striatum when compared to controls (H). Likewise, caRheb + caSTAT3, caSTAT3, or caRheb resulted in significantly increased survival [ANOVA, F(3, 81) = 21.16 bonferroni post-hoc, p < 0.0001] of dopaminergic neurons within the substantia nigra (I). Scale bar: A-F 500 µm; G 50 µm.

Journal: Brain research

Article Title: STAT3 protects dopaminergic neurons against degeneration in animal model of Parkinson's disease.

doi: 10.1016/j.brainres.2023.148691

Figure Lengend Snippet: Fig. 4. caSTAT3 protects dopaminergic neurons from 6-OHDA induced neurodegeneration. Data shows dopaminergic neuron survival 4 weeks after unilateral in jections of 6-OHDA in rats pre-injected with AAV/GFP (A,D), AAV/caSTAT3 (B,E,G) and AAV/caRheb (C,F) into the substantia nigra (SN). Coronal brain section (A,B, C) showing the extent of dopaminergic axon terminals with the striatum and the survival of dopaminergic neurons within the substantia nigra (D, E, F). Dramatic protection of striatal terminals and neurons is apparent in animals treated with either caSTAT3 (compare B & E to A & D, respectively) or caRheb (compare C & F to A & D, respectively). High magnification of TH + neurons from panel E shows neurons with a normal morphology (G). Quantitative analysis shows caRheb + caSTAT3, caSTAT3, or caRheb to statistically [ANOVA, F(3, 55) = 7.93, bonferroni post-hoc, p < 0.0001] preserve high density of dopaminergic nerve terminals within the striatum when compared to controls (H). Likewise, caRheb + caSTAT3, caSTAT3, or caRheb resulted in significantly increased survival [ANOVA, F(3, 81) = 21.16 bonferroni post-hoc, p < 0.0001] of dopaminergic neurons within the substantia nigra (I). Scale bar: A-F 500 µm; G 50 µm.

Article Snippet: Recombinant adeno-associated virus 2 (AAV2) carrying GFP or caRheb (kindly provided by Zhigang He, Harvard University, Boston, USA) was tagged with HA or caSTAT3 (pMXs-Stat3-C was a gift from Shinya Yamanaka (Addgene plasmid #13373) by helper virus-free system (Ayuso et al., 2010).

Techniques: Injection

Fig. 5. Neuroprotection was observed in caSTAT3 transfected nigral dopami nergic neurons after 6-OHDA insult: A) Neurons are labelled with TH. B) Neurons are labelled with cMyc and C) neurons are merged for TH and cMyc. Data shows dopaminergic neuron survival 4 weeks after unilateral injections of 6-OHDA in rats pre-injected with AAV/caSTAT3. Scale bar = 50 µm.

Journal: Brain research

Article Title: STAT3 protects dopaminergic neurons against degeneration in animal model of Parkinson's disease.

doi: 10.1016/j.brainres.2023.148691

Figure Lengend Snippet: Fig. 5. Neuroprotection was observed in caSTAT3 transfected nigral dopami nergic neurons after 6-OHDA insult: A) Neurons are labelled with TH. B) Neurons are labelled with cMyc and C) neurons are merged for TH and cMyc. Data shows dopaminergic neuron survival 4 weeks after unilateral injections of 6-OHDA in rats pre-injected with AAV/caSTAT3. Scale bar = 50 µm.

Article Snippet: Recombinant adeno-associated virus 2 (AAV2) carrying GFP or caRheb (kindly provided by Zhigang He, Harvard University, Boston, USA) was tagged with HA or caSTAT3 (pMXs-Stat3-C was a gift from Shinya Yamanaka (Addgene plasmid #13373) by helper virus-free system (Ayuso et al., 2010).

Techniques: Transfection, Injection

Fig. 6. caSTAT3 protects against 6-OHDA motor behavioral impairment: A) Amphetamine-induced rotational behavior was significantly decreased in caRheb + STAT3, caSTAT3, and caRheb expressing rats 4 weeks after 6-OHDA lesioning [ANOVA, F(3, 23) = 9.51, p = 0.0003] when compared to controls. B) After unilateral 6-OHDA lesions GFP treated animals showed a deficit in the use of the right (contralateral) paw, however, those treated with caRheb + caSTAT3, caSTAT3, or caRheb showed significant [ANOVA, F(3,17) = 8.29, p = 0.0013] use of the right paw in glass cylinder searching when compared to controls. Bonferroni post-hoc values for individual data points * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Brain research

Article Title: STAT3 protects dopaminergic neurons against degeneration in animal model of Parkinson's disease.

doi: 10.1016/j.brainres.2023.148691

Figure Lengend Snippet: Fig. 6. caSTAT3 protects against 6-OHDA motor behavioral impairment: A) Amphetamine-induced rotational behavior was significantly decreased in caRheb + STAT3, caSTAT3, and caRheb expressing rats 4 weeks after 6-OHDA lesioning [ANOVA, F(3, 23) = 9.51, p = 0.0003] when compared to controls. B) After unilateral 6-OHDA lesions GFP treated animals showed a deficit in the use of the right (contralateral) paw, however, those treated with caRheb + caSTAT3, caSTAT3, or caRheb showed significant [ANOVA, F(3,17) = 8.29, p = 0.0013] use of the right paw in glass cylinder searching when compared to controls. Bonferroni post-hoc values for individual data points * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Recombinant adeno-associated virus 2 (AAV2) carrying GFP or caRheb (kindly provided by Zhigang He, Harvard University, Boston, USA) was tagged with HA or caSTAT3 (pMXs-Stat3-C was a gift from Shinya Yamanaka (Addgene plasmid #13373) by helper virus-free system (Ayuso et al., 2010).

Techniques: Expressing

(A) Immunoblots for pY705 STAT3, pS727 STAT3, and total STAT3 in Trp53/Pten −/− cells that are ispinesib naive and resistant. (B–D) Quantitation of total STAT3/β actin (B), pY705 STAT3/total STAT3 (C), and pS727 STAT3/total STAT3 (D) in ispinesib-naive (blue) and -resistant (red) cells, with three biological replicates of each. Statistical significance assessed with a two-tailed t test. (E and F) Western blot intensity, normalized to β actin, of pY705 STAT3 (E) and pS727 STAT3 (F) in ispinesib-naive (Naive) and -resistant (Res) cells, with the former treated with DMSO vehicle (Veh) and the latter treated with DMSO vehicle (Veh), 500 nM saracatinib (Sara), or 500 nM dasatinib (Dasa). (G) Western blot intensity, normalized to β actin, of total STAT3 in ispinesib-naive (Naive) and -resistant (Res) cells, with the former treated with DMSO vehicle (Veh) and the latter treated with DMSO vehicle (Veh), 500 nM saracatinib (Sara), or 500 nM dasatinib (Dasa). For (E)–(G), please refer to and for the corresponding images of the western blots. Statistical significance determined using a pairwise two-tailed t test. (H–J) Quantitation of pY705 STAT3 (H), pS727 STAT3 (I), and total STAT3 (J), all normalized to β actin for ispinesib-naive cells treated with vehicle (solid blue circles; Naive Veh), ispinesib-resistant cells treated with vehicle (solid red circles; Res Veh), and ispinesib-resistant cells treated with 500 nM erlotinib (open red circles; Res Erlot). Statistical significance was determined by pairwise two-tailed t test. For (H)–(J), please refer to for the corresponding images of the western blots. (K) Dose-response curves for ispinesib-naive (solid blue circles) and -resistant (solid red circles) cells in the absence and presence of 75 nM ispinesib (open red circles) for the STAT3 inhibitor SH5–07. (L and M) Effect of shRNA suppression of STAT3 on ispinesib resistance. Please refer to for the corresponding western blot for STAT3, which shows >90% knockdown with two STAT3-directed shRNAs. Statistical significance determined using a pairwise two-tailed t test. (N) Ispinesib-naive and -resistant cells were treated for 24 h with 1 μM doxorubicin, and cell lysates were probed by western blot for full-length caspase 3 (FL Caspase 3) and cleaved caspase 3 (Cl Caspase 3). (O) Ispinesib-naive and -resistant cells were lysed, and mitochondria (Mito) were separated from the cytoplasm (Cyto) by centrifugation. Western blot shows that ispinesib resistance is associated with a marked increase in mitochondrial STAT3 that is phosphorylated on S727. Loading controls include α tubulin for the cytoplasmic and cytochrome c oxidase ( COX4 ) for the mitochondrial fractions. (P) Ispinesib-naive and -resistant cells were lysed, and nuclei (Nuc) were separated from the cytoplasm (Cyto) by centrifugation. Western blot shows that ispinesib resistance is associated with a marked increase in nuclear STAT3 that is phosphorylated on Y705. Loading controls include a tubulin for the cytoplasmic and histone H3 for the nuclear fractions. (Q) Ispinesib-naive cells were transfected with STAT3 S727A, STAT3 S727D, STAT3-C, or STAT3 S727D + STAT3-C constructs, each fused to the FLAG epitope. After confirmation of expression of the STAT3 mutant , cells were treated with a range of ispinesib concentrations, and cell viability was measured at 72 h. While transfection of either STAT3-S727D or STAT3-C increases the EC 50 of ispinesib by ~20-fold, co-transfection of both of these constructs is required to increase the ispinesib EC 50 to that seen for ispinesib-resistant cells ( ; ).

Journal: Cell reports

Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma

doi: 10.1016/j.celrep.2022.110991

Figure Lengend Snippet: (A) Immunoblots for pY705 STAT3, pS727 STAT3, and total STAT3 in Trp53/Pten −/− cells that are ispinesib naive and resistant. (B–D) Quantitation of total STAT3/β actin (B), pY705 STAT3/total STAT3 (C), and pS727 STAT3/total STAT3 (D) in ispinesib-naive (blue) and -resistant (red) cells, with three biological replicates of each. Statistical significance assessed with a two-tailed t test. (E and F) Western blot intensity, normalized to β actin, of pY705 STAT3 (E) and pS727 STAT3 (F) in ispinesib-naive (Naive) and -resistant (Res) cells, with the former treated with DMSO vehicle (Veh) and the latter treated with DMSO vehicle (Veh), 500 nM saracatinib (Sara), or 500 nM dasatinib (Dasa). (G) Western blot intensity, normalized to β actin, of total STAT3 in ispinesib-naive (Naive) and -resistant (Res) cells, with the former treated with DMSO vehicle (Veh) and the latter treated with DMSO vehicle (Veh), 500 nM saracatinib (Sara), or 500 nM dasatinib (Dasa). For (E)–(G), please refer to and for the corresponding images of the western blots. Statistical significance determined using a pairwise two-tailed t test. (H–J) Quantitation of pY705 STAT3 (H), pS727 STAT3 (I), and total STAT3 (J), all normalized to β actin for ispinesib-naive cells treated with vehicle (solid blue circles; Naive Veh), ispinesib-resistant cells treated with vehicle (solid red circles; Res Veh), and ispinesib-resistant cells treated with 500 nM erlotinib (open red circles; Res Erlot). Statistical significance was determined by pairwise two-tailed t test. For (H)–(J), please refer to for the corresponding images of the western blots. (K) Dose-response curves for ispinesib-naive (solid blue circles) and -resistant (solid red circles) cells in the absence and presence of 75 nM ispinesib (open red circles) for the STAT3 inhibitor SH5–07. (L and M) Effect of shRNA suppression of STAT3 on ispinesib resistance. Please refer to for the corresponding western blot for STAT3, which shows >90% knockdown with two STAT3-directed shRNAs. Statistical significance determined using a pairwise two-tailed t test. (N) Ispinesib-naive and -resistant cells were treated for 24 h with 1 μM doxorubicin, and cell lysates were probed by western blot for full-length caspase 3 (FL Caspase 3) and cleaved caspase 3 (Cl Caspase 3). (O) Ispinesib-naive and -resistant cells were lysed, and mitochondria (Mito) were separated from the cytoplasm (Cyto) by centrifugation. Western blot shows that ispinesib resistance is associated with a marked increase in mitochondrial STAT3 that is phosphorylated on S727. Loading controls include α tubulin for the cytoplasmic and cytochrome c oxidase ( COX4 ) for the mitochondrial fractions. (P) Ispinesib-naive and -resistant cells were lysed, and nuclei (Nuc) were separated from the cytoplasm (Cyto) by centrifugation. Western blot shows that ispinesib resistance is associated with a marked increase in nuclear STAT3 that is phosphorylated on Y705. Loading controls include a tubulin for the cytoplasmic and histone H3 for the nuclear fractions. (Q) Ispinesib-naive cells were transfected with STAT3 S727A, STAT3 S727D, STAT3-C, or STAT3 S727D + STAT3-C constructs, each fused to the FLAG epitope. After confirmation of expression of the STAT3 mutant , cells were treated with a range of ispinesib concentrations, and cell viability was measured at 72 h. While transfection of either STAT3-S727D or STAT3-C increases the EC 50 of ispinesib by ~20-fold, co-transfection of both of these constructs is required to increase the ispinesib EC 50 to that seen for ispinesib-resistant cells ( ; ).

Article Snippet: STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids.

Techniques: Western Blot, Quantitation Assay, Two Tailed Test, shRNA, Knockdown, Centrifugation, Transfection, Construct, FLAG-tag, Expressing, Mutagenesis, Cotransfection

(A) Western blots of two human GBM lines (L1 and 120) show no significant upregulation of Kif15 between ispinesib-naive ( N ) and -resistant ( R ) lines. Significance determined by a two-tailed t test. (B) Expression of EGFR is increased 3- to 4-fold in resistant ( R ) L1 and 120 GBM lines compared with the corresponding drug-naive ( N ) lines. Statistical significance determined using a pairwise two-tailed t test. (C–H) Phosphorylation of STAT3 increases in the human GBM cell lines L1 and 120 with development of ispinesib resistance. (C) Western blot for pY705, pS727, and total STAT3 in ispinesib naive ( N ) and resistant ( R ) GBM L1 and 120 cell lines. (D–H) Quantitation of total STAT3/β actin (D), pY705 STAT3/total STAT3 (E), pS727 STAT3/total STAT3 (F), pY705 STAT3/β actin (G), and pS727 STAT3/β actin (H) in ispinesib-naive ( N ) and -resistant ( R ) L1 and 120 cell lines. Statistical significance was determined by a two-tailed t test. Statistical significance determined using a pairwise two-tailed t test. (I–L) Ispinesib resistance in human L1 and 120 GBM cell lines can be reversed with saracatinib and SH5–07 but not with either erlotinib or dasatinib. (I and J) Dose-response curves for dasatinib (I) and erlotinib (J) show no effect of either drug as a single agent on ispinesib-naive (blue) or -resistant (red) cell lines, the latter in the presence of 50 nM ispinesib. (J and K) By contrast, both saracatinib (K) and SH5–07 (L) are active against ispinesib-resistant L1 and 120 cells in the presence of 50 nM ispinesib (red curves) but not against ispinesib-naive (blue curves) L1 and 120 cells. Relevant EC 50 values are listed in .

Journal: Cell reports

Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma

doi: 10.1016/j.celrep.2022.110991

Figure Lengend Snippet: (A) Western blots of two human GBM lines (L1 and 120) show no significant upregulation of Kif15 between ispinesib-naive ( N ) and -resistant ( R ) lines. Significance determined by a two-tailed t test. (B) Expression of EGFR is increased 3- to 4-fold in resistant ( R ) L1 and 120 GBM lines compared with the corresponding drug-naive ( N ) lines. Statistical significance determined using a pairwise two-tailed t test. (C–H) Phosphorylation of STAT3 increases in the human GBM cell lines L1 and 120 with development of ispinesib resistance. (C) Western blot for pY705, pS727, and total STAT3 in ispinesib naive ( N ) and resistant ( R ) GBM L1 and 120 cell lines. (D–H) Quantitation of total STAT3/β actin (D), pY705 STAT3/total STAT3 (E), pS727 STAT3/total STAT3 (F), pY705 STAT3/β actin (G), and pS727 STAT3/β actin (H) in ispinesib-naive ( N ) and -resistant ( R ) L1 and 120 cell lines. Statistical significance was determined by a two-tailed t test. Statistical significance determined using a pairwise two-tailed t test. (I–L) Ispinesib resistance in human L1 and 120 GBM cell lines can be reversed with saracatinib and SH5–07 but not with either erlotinib or dasatinib. (I and J) Dose-response curves for dasatinib (I) and erlotinib (J) show no effect of either drug as a single agent on ispinesib-naive (blue) or -resistant (red) cell lines, the latter in the presence of 50 nM ispinesib. (J and K) By contrast, both saracatinib (K) and SH5–07 (L) are active against ispinesib-resistant L1 and 120 cells in the presence of 50 nM ispinesib (red curves) but not against ispinesib-naive (blue curves) L1 and 120 cells. Relevant EC 50 values are listed in .

Article Snippet: STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids.

Techniques: Western Blot, Two Tailed Test, Expressing, Phospho-proteomics, Quantitation Assay

(A) Uniform manifold approximation and projection (UMAP) of all cells in the dataset, annotated by whether they are part of the naive or resistant populations. (B) Co-expression analysis of EGFR and SRC transcripts on original dataset. Cells were deemed EGFR or SRC positive based on whether they express any transcripts of the respective gene. See for subsample analysis to equalize coverage across conditions before doing co-expression analysis. (C) Cluster-by-cluster gene set enrichment analysis (GSEA) of the Cancer Hallmarks ‘‘IL6_JAK_STAT3_SIGNALING’’ pathway. Each cluster is colored based on its normalized enrichment score (NES) for the pathway. (D) GSEA of same IL-6/JAK/STAT3 pathway comparing all resistant cells with all naive cells. Normalized enrichment score, as well as p value and false discovery rate (FDR) q value, are displayed.

Journal: Cell reports

Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma

doi: 10.1016/j.celrep.2022.110991

Figure Lengend Snippet: (A) Uniform manifold approximation and projection (UMAP) of all cells in the dataset, annotated by whether they are part of the naive or resistant populations. (B) Co-expression analysis of EGFR and SRC transcripts on original dataset. Cells were deemed EGFR or SRC positive based on whether they express any transcripts of the respective gene. See for subsample analysis to equalize coverage across conditions before doing co-expression analysis. (C) Cluster-by-cluster gene set enrichment analysis (GSEA) of the Cancer Hallmarks ‘‘IL6_JAK_STAT3_SIGNALING’’ pathway. Each cluster is colored based on its normalized enrichment score (NES) for the pathway. (D) GSEA of same IL-6/JAK/STAT3 pathway comparing all resistant cells with all naive cells. Normalized enrichment score, as well as p value and false discovery rate (FDR) q value, are displayed.

Article Snippet: STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids.

Techniques: Expressing

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: Activation of STAT3 through combined SRC and EGFR signaling drives resistance to a mitotic kinesin inhibitor in glioblastoma

doi: 10.1016/j.celrep.2022.110991

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: STAT3 sequences from adenoviral plasmids encoding Flag-tagged mouse S727A-STAT3 (Addgene, #99262) and S727D-STAT3 (Addgene, #99263) were amplified by PCR (CloneAmp TM HiFi PCR, Takara Bio) using specific primers (CATTGGTAACTGTCAGAC CAAGTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGT AGAGCGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727A-STAT3 and CATTGGTAACTGTCAGACCAA GTTTACTCA; TGAGCCATGGTGGCGCTAGCT; CGCCACCATGGCTCAGTGG; AGGCCGCTCTACTTGTCATCGTCA; CAAGTAGAG CGGCCTCGAGCATGC; GGTCTGACAGTTACCAATGCTTAATCAG for S727D-STAT3), and subcloned into the pLenti Lifeact-EGFP BlastR plasmid (Addgene, #84383) to generate S727A and S727D-STAT3 expressing lentiviral plasmids.

Techniques: Virus, Plasmid Preparation, Recombinant, Membrane, Protease Inhibitor, Western Blot, Lysis, Transfection, Bicinchoninic Acid Protein Assay, Isolation, Cell Culture, Extraction, Software, Gene Expression, Mass Spectrometry

a HCT116 was transfected with pcDNA3.1-VMP1 vector for 48 h, the mRNA expression level of VMP1 and miR-21 was measured by qPCR. b HCT116 was transfected with the small activating RNA (saRNA) targeting VMP1 promoter for 48 h, then the mRNA expression of VMP1 was measured by qPCR. c HCT116 was transfected with saRNA-158 for 48 h, the mRNA and protein expression level of VMP1 was measured by Western blot and qPCR, miR-21 expression and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. d HCT116 was transfected with pEGFP-C3-hGLI3 vector for 48 h, the mRNA expression level of GLI3, VMP1, miR-21, and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. e HCT116 was transfected with pEGFP-N1-STAT3 vector for 48 h, the mRNA expression level of STAT3, VMP1, and the number of pri-miR-21 were measured by qPCR. f HCT116 was transfected with saRNA-158 and pEGFP-C3-hGLI3 vector, then CHIP-qPCR analyses using phospho-STAT3 (Tyr705) special antibody were performed. Primer specific for the binding sites of STAT3 to the pri-miR-21 promoter region. Data are presented as mean ± SD. *** P < 0.001, ** P < 0.01, * P < 0.05.

Journal: Cell Death & Disease

Article Title: An autoregulatory feedback loop of miR-21/VMP1 is responsible for the abnormal expression of miR-21 in colorectal cancer cells

doi: 10.1038/s41419-020-03265-4

Figure Lengend Snippet: a HCT116 was transfected with pcDNA3.1-VMP1 vector for 48 h, the mRNA expression level of VMP1 and miR-21 was measured by qPCR. b HCT116 was transfected with the small activating RNA (saRNA) targeting VMP1 promoter for 48 h, then the mRNA expression of VMP1 was measured by qPCR. c HCT116 was transfected with saRNA-158 for 48 h, the mRNA and protein expression level of VMP1 was measured by Western blot and qPCR, miR-21 expression and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. d HCT116 was transfected with pEGFP-C3-hGLI3 vector for 48 h, the mRNA expression level of GLI3, VMP1, miR-21, and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. e HCT116 was transfected with pEGFP-N1-STAT3 vector for 48 h, the mRNA expression level of STAT3, VMP1, and the number of pri-miR-21 were measured by qPCR. f HCT116 was transfected with saRNA-158 and pEGFP-C3-hGLI3 vector, then CHIP-qPCR analyses using phospho-STAT3 (Tyr705) special antibody were performed. Primer specific for the binding sites of STAT3 to the pri-miR-21 promoter region. Data are presented as mean ± SD. *** P < 0.001, ** P < 0.01, * P < 0.05.

Article Snippet: The anti-VMP1 rabbit monoclonal antibody (#12929), anti-TFEB rabbit monoclonal antibody (#37785) and anti-phospho-STAT3 (Tyr705) rabbit monoclonal antibody (#9145) were purchased from Cell Signaling Technology (CST, USA).

Techniques: Transfection, Plasmid Preparation, Expressing, Western Blot, ChIP-qPCR, Binding Assay

a RKO was transfected with pCIP-caTfeb vector and the construct dual-luciferase vectors, pmiRGLO-VMP1 promoter (−1000/+100) or pmiRGLO-pri-miR-21 promoter (−1000/+100), the luciferase activity was measured. b Luciferase report assay using the construct vector carrying the VMP1 promoter region, in which the predicted most likely three binding site (−648/−639, −560/−551, −33/−24, the upstream of the transcription start site of VMP1) with TFEB was mutant. c DNA Agar-gel electrophoresis from CHIP-qPCR assay, the amount of immunoprecipitated DNA isolated from TFEB special antibody/protein G magnetic beads was measured by qPCR. Primer specific for VMP1 promoter region (−116/+27). NC: negative control, PC: positive control, Group1: cells with no treat, Group2: cells with glucose starvation. d The mRNA expression level of TFEB, VMP1, miR-21 and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR, the protein expression level of TFEB and VMP1 were measured by Western blot after overexpression of the constitutively active TFEB by pCIP-caTfeb vector in RKO cells. e RKO was transfected with pCIP-caTfeb vector, then CHIP-qPCR analyses using phospho-STAT3 (Tyr705) special antibody were performed. Data are presented as mean ± SD. *** P < 0.001, ** P < 0.01, * P < 0.05.

Journal: Cell Death & Disease

Article Title: An autoregulatory feedback loop of miR-21/VMP1 is responsible for the abnormal expression of miR-21 in colorectal cancer cells

doi: 10.1038/s41419-020-03265-4

Figure Lengend Snippet: a RKO was transfected with pCIP-caTfeb vector and the construct dual-luciferase vectors, pmiRGLO-VMP1 promoter (−1000/+100) or pmiRGLO-pri-miR-21 promoter (−1000/+100), the luciferase activity was measured. b Luciferase report assay using the construct vector carrying the VMP1 promoter region, in which the predicted most likely three binding site (−648/−639, −560/−551, −33/−24, the upstream of the transcription start site of VMP1) with TFEB was mutant. c DNA Agar-gel electrophoresis from CHIP-qPCR assay, the amount of immunoprecipitated DNA isolated from TFEB special antibody/protein G magnetic beads was measured by qPCR. Primer specific for VMP1 promoter region (−116/+27). NC: negative control, PC: positive control, Group1: cells with no treat, Group2: cells with glucose starvation. d The mRNA expression level of TFEB, VMP1, miR-21 and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR, the protein expression level of TFEB and VMP1 were measured by Western blot after overexpression of the constitutively active TFEB by pCIP-caTfeb vector in RKO cells. e RKO was transfected with pCIP-caTfeb vector, then CHIP-qPCR analyses using phospho-STAT3 (Tyr705) special antibody were performed. Data are presented as mean ± SD. *** P < 0.001, ** P < 0.01, * P < 0.05.

Article Snippet: The anti-VMP1 rabbit monoclonal antibody (#12929), anti-TFEB rabbit monoclonal antibody (#37785) and anti-phospho-STAT3 (Tyr705) rabbit monoclonal antibody (#9145) were purchased from Cell Signaling Technology (CST, USA).

Techniques: Transfection, Plasmid Preparation, Construct, Luciferase, Activity Assay, Binding Assay, Mutagenesis, Nucleic Acid Electrophoresis, ChIP-qPCR, Immunoprecipitation, Isolation, Magnetic Beads, Negative Control, Positive Control, Expressing, Western Blot, Over Expression

When TFEB was activated and transported into the nuclear in cells, VMP1 transcript was upregulated and VMP1-miR-21 transcript was down-regulated, Meanwhile, pri-miR-21 transcript was also reduced due to the binding of transcription factors to pri-miR-21 promoter were blocked by TFEB-induced high transcriptional activation of VMP1, such as STAT3 (dashed lines). When VMP1 transcription was inhibited by TFEB phosphorylation, both VMP1-miR-21 and pri-miR-21 transcripts were increased. Subsequently, the high expression of miR-21 increased phosphorylation of AKT by inhibiting PTEN, and then phosphorylated AKT promoted phosphorylation of TFEB and repressed its nuclear translocation, leading to VMP1 transcription was further inhibited and miR-21 transcription was further increased (solid lines).

Journal: Cell Death & Disease

Article Title: An autoregulatory feedback loop of miR-21/VMP1 is responsible for the abnormal expression of miR-21 in colorectal cancer cells

doi: 10.1038/s41419-020-03265-4

Figure Lengend Snippet: When TFEB was activated and transported into the nuclear in cells, VMP1 transcript was upregulated and VMP1-miR-21 transcript was down-regulated, Meanwhile, pri-miR-21 transcript was also reduced due to the binding of transcription factors to pri-miR-21 promoter were blocked by TFEB-induced high transcriptional activation of VMP1, such as STAT3 (dashed lines). When VMP1 transcription was inhibited by TFEB phosphorylation, both VMP1-miR-21 and pri-miR-21 transcripts were increased. Subsequently, the high expression of miR-21 increased phosphorylation of AKT by inhibiting PTEN, and then phosphorylated AKT promoted phosphorylation of TFEB and repressed its nuclear translocation, leading to VMP1 transcription was further inhibited and miR-21 transcription was further increased (solid lines).

Article Snippet: The anti-VMP1 rabbit monoclonal antibody (#12929), anti-TFEB rabbit monoclonal antibody (#37785) and anti-phospho-STAT3 (Tyr705) rabbit monoclonal antibody (#9145) were purchased from Cell Signaling Technology (CST, USA).

Techniques: Binding Assay, Activation Assay, Phospho-proteomics, Expressing, Translocation Assay

FIG. 1. Stat3 activation inhibits A375 melanoma cell proliferation. A, nuclear extracts from ASER cells stimu- lated with 1 M 4HT for the indicated times were incubated with an immobi- lized Stat3 consensus oligonucleotide, and the amount of bound Stat3ER was ana- lyzed by Western blotting (left panel). The total amount of Stat3ER expressed in ASER cells was evaluated by Western blotting (right panel). B, ASER cells transfected with an APRE-luciferase re- porter and the Renilla plasmid were treated with OSM, 4HT (left panel), or the combination of OSM and 4HT (right panel) for 24 h. Luciferase activity was determined and normalized to the Renilla internal control. C, ASER cells were stim- ulated with 100 ng/ml OSM, 1 M 4HT, or the combination of OSM and 4HT, and cell number was determined at the times indicated. The experiments were per- formed a minimum of three times, and a typical result is shown. The bars repre- sent averages of three determinations S.D.

Journal: Journal of Biological Chemistry

Article Title: TEL/ETV6 Is a Signal Transducer and Activator of Transcription 3 (Stat3)-induced Repressor of Stat3 Activity

doi: 10.1074/jbc.m312581200

Figure Lengend Snippet: FIG. 1. Stat3 activation inhibits A375 melanoma cell proliferation. A, nuclear extracts from ASER cells stimu- lated with 1 M 4HT for the indicated times were incubated with an immobi- lized Stat3 consensus oligonucleotide, and the amount of bound Stat3ER was ana- lyzed by Western blotting (left panel). The total amount of Stat3ER expressed in ASER cells was evaluated by Western blotting (right panel). B, ASER cells transfected with an APRE-luciferase re- porter and the Renilla plasmid were treated with OSM, 4HT (left panel), or the combination of OSM and 4HT (right panel) for 24 h. Luciferase activity was determined and normalized to the Renilla internal control. C, ASER cells were stim- ulated with 100 ng/ml OSM, 1 M 4HT, or the combination of OSM and 4HT, and cell number was determined at the times indicated. The experiments were per- formed a minimum of three times, and a typical result is shown. The bars repre- sent averages of three determinations S.D.

Article Snippet: Proteins were analyzed by Western blotting, as previously described (15), with specific antibodies: c-Tel (kindly provided by G. Grosveld); TEL, Stat3, cyclin D2, cyclin D3, and cyclin E (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); phospho-Stat3 (Tyr705) and p27 Kip1 (Cell Signaling Technology, Beverly, MA); and cyclin D1 (Novocastra Laboratories Ltd., Newcastle upon Tyne, UK).

Techniques: Activation Assay, Incubation, Western Blot, Transfection, Luciferase, Plasmid Preparation, Activity Assay, Control

FIG. 2. OSM and 4HT synergize to induce Stat3 activity. A, schematic representation of chimeric receptors containing the extracel- lular and transmembrane region of the mouse EPO receptor fused to various portions of the gp130 cytoplasmic domain. EG, chimera with the full-length gp130 cytoplasmic tail; B, truncated gp130 construct containing only the membrane-proximal box 1/box 2 region; Y759 and Y814, B with a fusion of “tyrosine modules” mediating SHP2 or Stat3 binding, respectively. B, A375 cells were co-transfected with constructs coding for the indicated chimeric receptor and the Stat3-ER, together with an APRE-luciferase reporter plasmid and a Renilla plasmid, be- fore stimulation with EPO (3.5 units/ml), 1 M 4HT, or EPO/4HT for 24 h. Luciferase activity was determined as described in the legend to Fig. 1. C, ASER cells were treated with 4HT or the combination of 4HT and OSM for the indicated times. Binding of Stat3ER and Stat3 to an immobilized Stat3-specific consensus DNA probe was analyzed as de- scribed in Fig. 1. The blot was stripped and reprobed for phosphoryla- tion of Stat3 Tyr705 (PY-Stat3).

Journal: Journal of Biological Chemistry

Article Title: TEL/ETV6 Is a Signal Transducer and Activator of Transcription 3 (Stat3)-induced Repressor of Stat3 Activity

doi: 10.1074/jbc.m312581200

Figure Lengend Snippet: FIG. 2. OSM and 4HT synergize to induce Stat3 activity. A, schematic representation of chimeric receptors containing the extracel- lular and transmembrane region of the mouse EPO receptor fused to various portions of the gp130 cytoplasmic domain. EG, chimera with the full-length gp130 cytoplasmic tail; B, truncated gp130 construct containing only the membrane-proximal box 1/box 2 region; Y759 and Y814, B with a fusion of “tyrosine modules” mediating SHP2 or Stat3 binding, respectively. B, A375 cells were co-transfected with constructs coding for the indicated chimeric receptor and the Stat3-ER, together with an APRE-luciferase reporter plasmid and a Renilla plasmid, be- fore stimulation with EPO (3.5 units/ml), 1 M 4HT, or EPO/4HT for 24 h. Luciferase activity was determined as described in the legend to Fig. 1. C, ASER cells were treated with 4HT or the combination of 4HT and OSM for the indicated times. Binding of Stat3ER and Stat3 to an immobilized Stat3-specific consensus DNA probe was analyzed as de- scribed in Fig. 1. The blot was stripped and reprobed for phosphoryla- tion of Stat3 Tyr705 (PY-Stat3).

Article Snippet: Proteins were analyzed by Western blotting, as previously described (15), with specific antibodies: c-Tel (kindly provided by G. Grosveld); TEL, Stat3, cyclin D2, cyclin D3, and cyclin E (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); phospho-Stat3 (Tyr705) and p27 Kip1 (Cell Signaling Technology, Beverly, MA); and cyclin D1 (Novocastra Laboratories Ltd., Newcastle upon Tyne, UK).

Techniques: Activity Assay, Construct, Membrane, Binding Assay, Transfection, Luciferase, Plasmid Preparation

FIG. 4. Stat3 target genes. Genes whose expression was changed after 24-h 4HT treatment of ASER cells were identified and hierarchi- cally clustered, based on their expression levels after 4-h 4HT, 24-h OSM, 24-h 4HT, and 24-h OSM/4HT treatments. Data are presented in a matrix format: each row represents a single gene, and each column represents an experimental sample. Red, expression above the median value; blue, expression below the median value.

Journal: Journal of Biological Chemistry

Article Title: TEL/ETV6 Is a Signal Transducer and Activator of Transcription 3 (Stat3)-induced Repressor of Stat3 Activity

doi: 10.1074/jbc.m312581200

Figure Lengend Snippet: FIG. 4. Stat3 target genes. Genes whose expression was changed after 24-h 4HT treatment of ASER cells were identified and hierarchi- cally clustered, based on their expression levels after 4-h 4HT, 24-h OSM, 24-h 4HT, and 24-h OSM/4HT treatments. Data are presented in a matrix format: each row represents a single gene, and each column represents an experimental sample. Red, expression above the median value; blue, expression below the median value.

Article Snippet: Proteins were analyzed by Western blotting, as previously described (15), with specific antibodies: c-Tel (kindly provided by G. Grosveld); TEL, Stat3, cyclin D2, cyclin D3, and cyclin E (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); phospho-Stat3 (Tyr705) and p27 Kip1 (Cell Signaling Technology, Beverly, MA); and cyclin D1 (Novocastra Laboratories Ltd., Newcastle upon Tyne, UK).

Techniques: Expressing

FIG. 5. TEL protein level is increased following Stat3 activation in human cancer cells. A, ASER cells were stimulated with 4HT for the indicated times, nuclear extracts were prepared, and the abundance of TEL protein was determined by immunoblot analysis. B, various human cancer cell lines were stimulated for 24 h with OSM or IL-6, nuclear extracts were prepared, and the protein level of TEL and active Stat3 (PY-Stat3) was determined by Western blotting (WB).

Journal: Journal of Biological Chemistry

Article Title: TEL/ETV6 Is a Signal Transducer and Activator of Transcription 3 (Stat3)-induced Repressor of Stat3 Activity

doi: 10.1074/jbc.m312581200

Figure Lengend Snippet: FIG. 5. TEL protein level is increased following Stat3 activation in human cancer cells. A, ASER cells were stimulated with 4HT for the indicated times, nuclear extracts were prepared, and the abundance of TEL protein was determined by immunoblot analysis. B, various human cancer cell lines were stimulated for 24 h with OSM or IL-6, nuclear extracts were prepared, and the protein level of TEL and active Stat3 (PY-Stat3) was determined by Western blotting (WB).

Article Snippet: Proteins were analyzed by Western blotting, as previously described (15), with specific antibodies: c-Tel (kindly provided by G. Grosveld); TEL, Stat3, cyclin D2, cyclin D3, and cyclin E (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); phospho-Stat3 (Tyr705) and p27 Kip1 (Cell Signaling Technology, Beverly, MA); and cyclin D1 (Novocastra Laboratories Ltd., Newcastle upon Tyne, UK).

Techniques: Activation Assay, Western Blot

FIG. 6. TEL is a negative regulator of Stat3 activity. Cells were transfected with LacZ siRNA or TEL siRNA for 48 h prior to further treatments. A, TEL protein levels were evaluated in nuclear lysates from cells treated with 4HT for 24 h. WB, Western blot. B, ASER cell number was determined after 72-h 4HT or OSM treatment and ex- pressed as a percentage of inhibition relative to unstimulated cells. C, ASER cells were transfected with an APRE-luciferase reporter plasmid and a Renilla plasmid, and Stat3 activity was assessed after the addi- tion of 4HT or OSM for 24 h. Luciferase activity was determined as described in the legend to Fig. 1.

Journal: Journal of Biological Chemistry

Article Title: TEL/ETV6 Is a Signal Transducer and Activator of Transcription 3 (Stat3)-induced Repressor of Stat3 Activity

doi: 10.1074/jbc.m312581200

Figure Lengend Snippet: FIG. 6. TEL is a negative regulator of Stat3 activity. Cells were transfected with LacZ siRNA or TEL siRNA for 48 h prior to further treatments. A, TEL protein levels were evaluated in nuclear lysates from cells treated with 4HT for 24 h. WB, Western blot. B, ASER cell number was determined after 72-h 4HT or OSM treatment and ex- pressed as a percentage of inhibition relative to unstimulated cells. C, ASER cells were transfected with an APRE-luciferase reporter plasmid and a Renilla plasmid, and Stat3 activity was assessed after the addi- tion of 4HT or OSM for 24 h. Luciferase activity was determined as described in the legend to Fig. 1.

Article Snippet: Proteins were analyzed by Western blotting, as previously described (15), with specific antibodies: c-Tel (kindly provided by G. Grosveld); TEL, Stat3, cyclin D2, cyclin D3, and cyclin E (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); phospho-Stat3 (Tyr705) and p27 Kip1 (Cell Signaling Technology, Beverly, MA); and cyclin D1 (Novocastra Laboratories Ltd., Newcastle upon Tyne, UK).

Techniques: Activity Assay, Transfection, Western Blot, Inhibition, Luciferase, Plasmid Preparation

FIG. 7. TEL-induced repression of Stat3 transcriptional activity does not require the TEL DNA binding domain but depends on the TEL pointed domain. A, ASER cells were transfected with the TEL construct along with an APRE-luciferase reporter plasmid and a Renilla plasmid 24 h prior to stimulated with 4HT alone or 4HT and TSA (250 nM) for 24 h. Luciferase activity was normalized to the Renilla internal control. B, schematic diagram of TEL mutants. DBDM, DNA-binding domain mutant; P, pointed domain. C and D, ASER cells and HEK-293T cells were transfected with different TEL mutants, an APRE-luciferase reporter plasmid and a Renilla plasmid. Cells were treated with 4HT or OSM for 24 h, before determination of luciferase activity, as described in the legend to Fig. 1.

Journal: Journal of Biological Chemistry

Article Title: TEL/ETV6 Is a Signal Transducer and Activator of Transcription 3 (Stat3)-induced Repressor of Stat3 Activity

doi: 10.1074/jbc.m312581200

Figure Lengend Snippet: FIG. 7. TEL-induced repression of Stat3 transcriptional activity does not require the TEL DNA binding domain but depends on the TEL pointed domain. A, ASER cells were transfected with the TEL construct along with an APRE-luciferase reporter plasmid and a Renilla plasmid 24 h prior to stimulated with 4HT alone or 4HT and TSA (250 nM) for 24 h. Luciferase activity was normalized to the Renilla internal control. B, schematic diagram of TEL mutants. DBDM, DNA-binding domain mutant; P, pointed domain. C and D, ASER cells and HEK-293T cells were transfected with different TEL mutants, an APRE-luciferase reporter plasmid and a Renilla plasmid. Cells were treated with 4HT or OSM for 24 h, before determination of luciferase activity, as described in the legend to Fig. 1.

Article Snippet: Proteins were analyzed by Western blotting, as previously described (15), with specific antibodies: c-Tel (kindly provided by G. Grosveld); TEL, Stat3, cyclin D2, cyclin D3, and cyclin E (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); phospho-Stat3 (Tyr705) and p27 Kip1 (Cell Signaling Technology, Beverly, MA); and cyclin D1 (Novocastra Laboratories Ltd., Newcastle upon Tyne, UK).

Techniques: Activity Assay, Binding Assay, Transfection, Construct, Luciferase, Plasmid Preparation, Control, Mutagenesis

FIG. 8. TEL interacts with Stat3. A, extracts from cells expressing TEL or TEL deletion mutants P and 122–217 (217) were subjected to immunoprecipitation with an anti-Stat3 antibody and analyzed by Western blotting using anti-Stat3 and anti-TEL antibodies. B, nuclear extracts were prepared from control or OSM-treated ASER cells. Ex- tracts were subjected to immunoprecipitation (IP) with anti-Stat3 an- tibody (left panel), whereas TEL was pulled down using an immobilized ETS consensus site-containing oligonucleotide (middle panel) before Western blotting (WB) analysis with anti-TEL and anti-Stat3 antibod- ies. Right panel, levels of Stat3 and TEL in total nuclear lysates were determined by Western blotting.

Journal: Journal of Biological Chemistry

Article Title: TEL/ETV6 Is a Signal Transducer and Activator of Transcription 3 (Stat3)-induced Repressor of Stat3 Activity

doi: 10.1074/jbc.m312581200

Figure Lengend Snippet: FIG. 8. TEL interacts with Stat3. A, extracts from cells expressing TEL or TEL deletion mutants P and 122–217 (217) were subjected to immunoprecipitation with an anti-Stat3 antibody and analyzed by Western blotting using anti-Stat3 and anti-TEL antibodies. B, nuclear extracts were prepared from control or OSM-treated ASER cells. Ex- tracts were subjected to immunoprecipitation (IP) with anti-Stat3 an- tibody (left panel), whereas TEL was pulled down using an immobilized ETS consensus site-containing oligonucleotide (middle panel) before Western blotting (WB) analysis with anti-TEL and anti-Stat3 antibod- ies. Right panel, levels of Stat3 and TEL in total nuclear lysates were determined by Western blotting.

Article Snippet: Proteins were analyzed by Western blotting, as previously described (15), with specific antibodies: c-Tel (kindly provided by G. Grosveld); TEL, Stat3, cyclin D2, cyclin D3, and cyclin E (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); phospho-Stat3 (Tyr705) and p27 Kip1 (Cell Signaling Technology, Beverly, MA); and cyclin D1 (Novocastra Laboratories Ltd., Newcastle upon Tyne, UK).

Techniques: Expressing, Immunoprecipitation, Western Blot, Control